PDE6D (NM_001291018) Human Untagged Clone
CAT#: SC333460
PDE6D (untagged) - Human phosphodiesterase 6D, cGMP-specific, rod, delta (PDE6D), transcript variant 2
"NM_001291018" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "PDE6D"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PDE6D |
Synonyms | JBTS22; PDED |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333460 representing NM_001291018.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAGCCAAGGACGAGCGGGCCAGGGAGATCCTGAGGGGCTTCAAACTAAATTGGATGAACCTTCGG GATGCTGAGACAGGGAAGATACTCTGGCAAGGAACAGAAGACCTGTCTGTCCCTGGTGTGGAGCATGAA GCCCGTGTTCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAACTTAATTTTTCTTCGACAGAA CAAATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGGCAATGCCTAGAAGTGGGAACGTTA TCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001291018 |
Insert Size | 282 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001291018.1 |
RefSeq Size | 1108 bp |
RefSeq ORF | 282 bp |
Locus ID | 5147 |
UniProt ID | O43924 |
Cytogenetics | 2q37.1 |
Protein Pathways | Progesterone-mediated oocyte maturation, Purine metabolism |
MW | 10.8 kDa |
Gene Summary | This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region resulting in a frameshift compared to variant 1. The encoded protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.