PDE6D (NM_001291018) Human Untagged Clone

CAT#: SC333460

PDE6D (untagged) - Human phosphodiesterase 6D, cGMP-specific, rod, delta (PDE6D), transcript variant 2


  "NM_001291018" in other vectors (2)

Reconstitution Protocol

USD 165.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


PDE6D rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "PDE6D"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDE6D
Synonyms JBTS22; PDED
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333460 representing NM_001291018.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGCCAAGGACGAGCGGGCCAGGGAGATCCTGAGGGGCTTCAAACTAAATTGGATGAACCTTCGG
GATGCTGAGACAGGGAAGATACTCTGGCAAGGAACAGAAGACCTGTCTGTCCCTGGTGTGGAGCATGAA
GCCCGTGTTCCCAAGAAAATCCTCAAGTGCAAGGCAGTGTCTCGAGAACTTAATTTTTCTTCGACAGAA
CAAATGGAAAAATTCCGCCTGGAACAAAAAGTTTACTTCAAAGGGCAATGCCTAGAAGTGGGAACGTTA
TCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291018
Insert Size 282 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291018.1
RefSeq Size 1108 bp
RefSeq ORF 282 bp
Locus ID 5147
UniProt ID O43924
Cytogenetics 2q37.1
Protein Pathways Progesterone-mediated oocyte maturation, Purine metabolism
MW 10.8 kDa
Gene Summary This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (2) lacks an alternate exon in the 3' coding region resulting in a frameshift compared to variant 1. The encoded protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.