COMMD6 (NM_001287393) Human Untagged Clone
CAT#: SC333316
COMMD6 (untagged) - Human COMM domain containing 6 (COMMD6), transcript variant 4
"NM_001287393" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "COMMD6"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | COMMD6 |
Synonyms | Acrg |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333316 representing NM_001287393.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGTGAGCTCAGACACTTGCAGATCTCTTAAGTATCCTTACGTTGCAGTGATGCTAAAAGTGGCA GATCATTCAGGCCAAGTAAAGACCAAGTGCTTTGAAATGACGATTCCACAGTTTCAGAATTTCTACAGA CAGTTCAAGGAAATTGCTGCAGTTATTGAAACGGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287393 |
Insert Size | 177 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287393.1 |
RefSeq Size | 1860 bp |
RefSeq ORF | 177 bp |
Locus ID | 170622 |
Cytogenetics | 13q22.2 |
MW | 6.6 kDa |
Gene Summary | COMMD6 belongs to a family of NF-kappa-B (see RELA; MIM 164014)-inhibiting proteins characterized by the presence of a COMM domain (see COMMD1; MIM 607238) (de Bie et al., 2006 [PubMed 16573520]).[supplied by OMIM, Mar 2009] Transcript Variant: This variant (4) is alternatively spliced in the 5' region (which results in translation initiation from an in-frame downstream start codon) and lacks an in-frame coding exon in the 3' region compared to variant 1. The resulting isoform (c) has a shorter N-terminus and lacks a 13 aa protein segment compared to isoform 1. Variants 3-5 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.