CHST15 (NM_001270765) Human Untagged Clone

CAT#: SC332999

CHST15 (untagged) - Homo sapiens carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 (CHST15), transcript variant 4


  "NM_001270765" in other vectors (2)

Reconstitution Protocol

USD 519.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-GALNAC4S-6ST Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CHST15"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHST15
Synonyms BRAG; GALNAC4S-6ST
Vector pCMV6-Entry
Sequence Data
>SC332999 representing NM_001270765.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCACTGCATTAATTGCTGCATACAGCTGTTACCCGACGGCGCACACAAGCAGCAGGTCAACTGC
CAAGGGGGCCCCCATCACGGTCACCAGGCGTGCCCCACGTGCAAAGGAGAAAACAAAATTCTGTTTCGT
GTGGACAGTAAGCAGATGAACTTGCTTGCTGTTCTCGAAGTGAGGACTGAAGGGAACGAAAACTGGGGT
GGGTTTTTGCGCTTCAAAAAGGGGAAGCGATGTAGCCTCGTTTTTGGACTGATAATAATGACCTTGGTA
ATGGCTTCTTACATCCTTTCTGGGGCCCACCAAGAGCTTCTGATCTCATCACCTTTCCATTACGGAGGC
TTCCCCAGCAACCCCAGCTTGATGGACAGCGAAAACCCAAGTGACACAAAGGAGCATCACCACCAATCC
TCTGTAAATAATATTTCATACATGAAGGACTATCCAAGCATTAAATTAATTATCAACAGCATCACAACT
AGGATTGAGTTCACGACCAGACAGCTCCCAGACTTAGAAGACCTTAAGAAGCAGGAGTTGCATATGTTT
TCAGTCATCCCCAACAAATTCCTTCCAAACAGTAAGAGCCCCTGTTGGTACGAGGAGTTCTCGGGGCAG
AACACCACCGACCCCTACCTCACCAACTCCTACGTGCTCTACTCCAAGCGCTTCCGCTCCACCTTCGAC
GCCCTGCGCAAGGCCTTCTGGGGCCACCTGGCGCACGCGCACGGGAAGCACTTCCGCCTGCGCTGCCTG
CCGCACTTCTACATCATAGGGCAGCCCAAGTGCGGGACCACAGACCTCTATGACCGCCTGCGGCTGCAC
CCTGAGGTCAAGTTCTCCGCCATCAAGGAGCCACACTGGTGGACCCGGAAGCGCTTTGGAATCGTCCGC
CTAAGAGATGGGCTGCGAGACCGCTATCCCGTGGAAGATTATCTGGACCTCTTTGACCTGGCCGCACAC
CAGATCCATCAAGGACTGCAGGCCAGCTCTGCAAAGGAGCAGAGCAAGATGAATACAATCATTATCGGG
GAGGCCAGTGCCTCCACGATGTGGGATAATAATGCCTGGACGTTCTTCTACGACAACAGCACGGATGGC
GAGCCACCGTTTCTGACGCAGGACTTCATCCACGCCTTTCAGCCAAATGCCAGACTGATTGTCATGCTC
AGGGACCCTGTGGAGAGGTTGTACTCAGACTATCTCTACTTTGCAAGTTCGAATAAATCCGCGGACGAC
TTCCATGAGAAAGTGACAGAAGCACTGCAGCTGTTTGAAAATTGCATGCTTGATTATTCACTGCGCGCC
TGCGTCTACAACAACACCCTCAACAACGCCATGCCTGTGTGTACCCCCCCCCCCCGTACCCCCCGAGCT
GGCCCCTGGCAGAAGGAGCTGGTTTGTTGTTATTATGCAAGCGGCATTGTGGGTTTGCGTTTCAGCATA
GGAACAGAGAGAAGCGTTTTAATGTGCAAATGCTGTTCCCCATTATTCATGGATGTAAAAGCTGAAAAC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001270765
Insert Size 1521 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270765.1
RefSeq Size 3618 bp
RefSeq ORF 1521 bp
Locus ID 51363
UniProt ID Q7LFX5
Cytogenetics 10q26.13
Protein Families Transmembrane
Protein Pathways Chondroitin sulfate biosynthesis
MW 58.1 kDa
Gene Summary Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (4) differs in the 5' UTR, 3' UTR, and 3' coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Variants 2 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.