CSNK1G3 (NM_001270573) Human Untagged Clone

CAT#: SC332979

CSNK1G3 (untagged) - Homo sapiens casein kinase 1, gamma 3 (CSNK1G3), transcript variant 6


  "NM_001270573" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit Polyclonal Anti-CSNK1G3 Antibody
    • 100 ul

USD 539.00

Other products for "CSNK1G3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CSNK1G3
Synonyms CKI-gamma 3; CSNK1G3L
Vector pCMV6-Entry
Sequence Data
>SC332979 representing NM_001270573.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAATCAAGAGCACCACAGCTACATTTGGAATACAGATTCTATAAGCAGTTAGGATCTGGAGATGGT
ATACCTCAAGTTTACTATTTCGGCCCTTGTGGTAAATACAATGCTATGGTGCTGGAACTGCTGGGACCT
AGTTTGGAAGACTTGTTTGACTTGTGTGACAGAACATTTTCTCTTAAAACAGTTCTCATGATAGCTATA
CAACTGATTTCTCGCATGGAATATGTCCATTCAAAGAACTTGATATACAGAGATGTAAAACCTGAGAAC
TTCTTAATAGGACGACCAGGAAACAAAACCCAGCAAGTTATTCACATTATAGATTTTGGTTTGGCAAAG
GAATATATTGATCCGGAGACAAAGAAACACATACCATACAGAGAACACAAGAGCCTTACAGGAACAGCT
AGATATATGAGCATAAACACACATTTAGGAAAAGAACAAAGTAGAAGAGACGATTTAGAAGCTTTAGGT
CATATGTTCATGTATTTTCTGAGAGGCAGTCTTCCTTGGCAAGGCTTAAAGGCTGACACATTAAAGGAG
AGGTATCAGAAAATTGGAGATACAAAACGGGCTACACCAATAGAAGTGTTATGTGAAAATTTTCCAGAA
ATGGCAACATATCTTCGTTATGTAAGAAGGCTAGATTTTTTTGAAAAACCAGACTATGACTACTTAAGA
AAGCTTTTTACTGACTTGTTTGATCGAAAAGGATATATGTTTGATTATGAATATGACTGGATTGGTAAA
CAGTTGCCTACTCCAGTGGGTGCAGTTCAGCAAGATCCTGCTCTGTCATCAAACAGAGAAGCACATCAA
CACAGAGATAAGATGCAACAATCCAAAAACCAGGTTGTAAGTTCTACAAATGGAGAGTTAAACACAGAT
GACCCCACCGCAGGACGTTCAAATGCACCCATCACAGCCCCTACTGAAGTAGAAGTGATGGATGAAACC
AACTGCCAGAAAGTGTTGAACATGTGGTGCTGCTGTTTTTTCAAACGAAGGAAAAGGAAAACCATACAG
CGCCACAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001270573
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270573.1
RefSeq Size 4226 bp
RefSeq ORF 1047 bp
Locus ID 1456
UniProt ID Q9Y6M4
Cytogenetics 5q23.2
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Hedgehog signaling pathway
MW 40.7 kDa
Gene Summary This gene encodes a member of a family of serine/threonine protein kinases that phosphorylate caseins and other acidic proteins. A related protein in the African clawed frog participates in the transmission of Wnt/beta-catenin signaling. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (6) differs in the 5' UTR and has multiple differences in the coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (6) has a shorter N-terminus, compared to isoform 1. Variants 6, 16, and 17 all encode the same isoform (6). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.