UBE3B (NM_001270449) Human Untagged Clone

CAT#: SC332940

UBE3B (untagged) - Homo sapiens ubiquitin protein ligase E3B (UBE3B), transcript variant 4


  "NM_001270449" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
UBE3B mouse monoclonal antibody,clone OTI3F10
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "UBE3B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UBE3B
Synonyms BPIDS; KOS
Vector pCMV6-Entry
Sequence Data
>SC332940 representing NM_001270449.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCACCCTGTCTCAGACCTCGAGAGCATGGTTCATCGATAGAGCCCGTCAGGCACGAGAAGAAAGG
CTTGTGCAGAAGGAACGGGAGCGGGCAGCTGTTGTGATCCAGGCCCATGTCCGGAGTTTTCTCTGTCGG
AGTCGACTGCAGAGAGATATCAGGAGAGAGATTGATGACTTTTTTAAAGCAGATGACCCTGAGTCCACT
AAAAGAAGTGCACTTTGTATTTTCAAGATTGCCAGGAAACTGCTGTTCCTATTCAGAATCAAAGAGGAT
AATGAGAGATTTGAGAAGTTGTGTCGCAGCATCCTGAGCAGCATGGATGCTGAGAATGAGCCTAAGGTG
TGGTATGTGTCCCTGGCTTGTTCTAAGGACCTCACCCTCCTTTGGATTCAACAGATCAAGAACATTTTG
TGGTACTGCTGTGATTTTCTCAAGCAGCTCAAGCCTGAAATCCTGCAGGACTCCCGACTCATCACCCTG
TACCTCACGATGCTTGTCACCTTCACAGACACTTCAACGTGGAAAATTCTTCGGGGAAAAGGTGAAAGT
CTTCGACCAGCGATGAACCACATTTGTGCAAATATAATGGGACATCTCAACCAGCATGGATTTTATTCT
GTGCTGCAGTGCTGTGATGGGCTGTTTCCTGATTTGGTTTCATATGCTCCTCACAACAACCCTGTGAGG
TGGTCCGTTGGCAGAAGCTGGTATGACTGGCAGTTGTCTCGCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001270449
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270449.1
RefSeq Size 1491 bp
RefSeq ORF 735 bp
Locus ID 89910
UniProt ID Q7Z3V4
Cytogenetics 12q24.11
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
MW 28.9 kDa
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (4) contains an alternate 3' exon, compared to variant 1. This difference results in a distinct 3' UTR and 3' coding region and a protein (isoform 3) with a shorter and distinct C-terminus, compared to isoform 1. Variants 4-6 encode the same protein (isoform 3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.