ING1 (NM_001267728) Human Untagged Clone

CAT#: SC332877

ING1 (untagged) - Homo sapiens inhibitor of growth family, member 1 (ING1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ING1
• Synonyms: p24ING1c; p33; p33ING1; p33ING1b; p47; p47ING1a
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332877 representing NM_001267728.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGG
  CCTAGCGCAATAACTGAGATCCTGAAGGAGCTAGACGAGTGCTACGAGCGCTTCAGTCGCGAGACAGAC
  GGGGCGCAGAAGCGGCGGATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTGGGCGAC
  GAGAAGATCCAGATCGTGAGCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGGCAGGTGGACAGCCAC
  GTGGAGCTGTTCGAGGCGCAGCAGGAGCTGGGCGACACAGCGGGCAACAGCGGCAAGGCTGGCGCGGAC
  AGGCCCAAAGGCGAGGCGGCAGCGCAGGCTGACAAGCCCAACAGCAAGCGCTCACGGCGGCAGCGCAAC
  AACGAGAACCGTGAGAACGCGTCCAGCAACCACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAG
  AAGAAGGCCAAGACCTCCAAGAAGAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCC
  GACCTCCCCATCGACCCCAACGAACCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATC
  GGCTGCGACAACGACGAGTGCCCCATCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAATCATAAACCC
  AAGGGCAAGTGGTACTGTCCCAAGTGCCGGGGGGAGAACGAGAAGACCATGGACAAAGCCCTGGAGAAA
  TCCAAAAAAGAGAGGGCTTACAACAGGTAG
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001267728
• Insert Size: 789 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001267728.1
• RefSeq Size: 1956 bp
• RefSeq ORF: 789 bp
• Locus ID: 3621
• UniProt ID: Q9UK53
• Cytogenetics: 13q34
• Protein Families: Druggable Genome, Transcription Factors
• MW: 29.6 kDa
• Gene Summary: This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (5) lacks an internal segment in the 5' coding region, compared to variant 4. The resulting isoform (E) lacks an internal segment, as compared to isoform D.