BLNK (NM_001258441) Human Untagged Clone

CAT#: SC332711

BLNK (untagged) - Homo sapiens B-cell linker (BLNK), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BLNK
• Synonyms: AGM4; BASH; bca; BLNK-S; LY57; SLP-65; SLP65
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332711 representing NM_001258441.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGACAAGCTTAATAAAATAACCGTCCCCGCCAGTCAGAAGTTGAGGCAGCTTCAAAAGATGGTCCAT
  GATATTAAAAACAATGAAGGTGGAATAATGAATAAAATCAAAAAGCTAAAAGTCAAAGCACCTCCAAGT
  GTTCCTCGAAGGGACTACGCTTCAGAGAGCCCTGCTGACGAAGAGGAGCAGTGGTCCGATGACTTTGAC
  AGCGACTATGAAAATCCAGATGAGCACTCGGACTCAGAGATGTACGTGATGCCCGCCGAGGAGAACGCT
  GATGACAGCTACGAGCCGCCTCCAGTAGAGCAGGAAACCAGGCCGGTTCACCCAGCCCTGCCCTTCGCC
  AGAGGCGAGTATATAGACAATCGATCAAGCCAGAGGCATTCCCCACCCTTCAGCAAGACACTTCCCAGT
  AAGCCCAGCTGGCCTTCAGAGAAAGCAAGGCTCACCTCCACCCTGCCGGCCCTGACTGCTTTGCAGAAA
  CCTCAAGTCCCACCCAAACCCAAAGGCCTCCTTGAGGATGAGGCTGATTATGTGGTCCCCGTGGAAGAT
  AATGATGAAAACTATATTCATCCCACAGAAAGCAGTTCACCTCCACCTGAAAAAGGTCGAAACAGTGGG
  GCCTGGGAAACCAAGTCACCTCCACCAGCTGCACCATCCCCGTTGCCACGGGCCGGGAAAAAACCAACG
  ACACCACTGAAGACAACTCCAGTTGCCTCTCAACAGAATGCTTCAAGTGTTTGTGAAGAAAAACCTATA
  CCTGCTGAACGCCACCGAGGGTCAAGTCACAGACAAGAAGCTGTGCAGTCACCAGTGTTTCCTCCTGCC
  CAGAAACAAATCCACCAAAAACCCATACCTCTGCCAAGATTTACAGAAGGGGGAAACCCAACTGTGGAT
  GGGCCCCTACCCAGCTTTTCATCTAATTCCACTATTTCAGAACAGGAAGCTGGCGTTCTCTGCAAGCCA
  TGGTATGCTGGAGCCTGTGATCGAAAGTCTGCTGAAGAGGCATTGCACAGATCAAACAAGTACTTTGGA
  AGTGTTGCTGAAATCATCAGGAATCATCAACATAGTCCTTTGGTTCTTATTGACAGTCAGAATAACACA
  AAAGATTCCACCAGACTGAAGTATGCAGTTAAAGTTTCATAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258441
• Insert Size: 1146 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258441.1
• RefSeq Size: 1544 bp
• RefSeq ORF: 1146 bp
• Locus ID: 29760
• Cytogenetics: 10q24.1
• Protein Families: Druggable Genome
• Protein Pathways: B cell receptor signaling pathway, Primary immunodeficiency
• MW: 42.2 kDa
• Gene Summary: This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (4) lacks two in-frame exons in the mid- and 3' coding regions compared to variant 1, resulting in a shorter isoform (4) compared to isoform 1.