TMEM218 (NM_001258246) Human Untagged Clone

CAT#: SC332604

TMEM218 (untagged) - Homo sapiens transmembrane protein 218 (TMEM218), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM218
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332604 representing NM_001258246.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCCCTGGTGTCTTCTACCAGTTCTTAGTGTGTTGCACTGGAGCACAGAGGACACTCGATCGTGCGGC
  GCGCAGGGCGGGGGGCCGCCGCTGCCTCCCCGCGGGATGGCTGGCACTGTGCTCGGAGTCGGTGCGGGC
  GTGTTCATCTTAGCCCTGCTCTGGGTGGCAGTGCTGCTGCTGTGTGTGCTGCTGTCCAGAGCCTCCGGG
  GCGGCGAGGTTCTCTGTCATTTTTTTATTCTTCGGTGCTGTGATCATCACATCAGTTCTGTTGCTTTTC
  CCGCGAGCTGGTGAATTCCCAGCCCCAGAAGTGGAAGTTAAGATTGTGGATGACTTTTTCATTGGCCGC
  TATGTCCTGCTGGCTTTCCTTAGTGCCATCTTCCTTGGAGGCCTCTTCTTGGTTTTAATCCATTATGTT
  CTGGAGCCGATCTATGCCAAACCACTGCACTCCTACTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001258246
• Insert Size: 453 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001258246.1
• RefSeq Size: 3988 bp
• RefSeq ORF: 453 bp
• Locus ID: 219854
• UniProt ID: A2RU14
• Cytogenetics: 11q24.2
• Protein Families: Transmembrane
• MW: 16.2 kDa
• Gene Summary: May be involved in ciliary biogenesis or function.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, and 4 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.