TMEM218 (NM_001258238) Human Untagged Clone

CAT#: SC332596

TMEM218 (untagged) - Homo sapiens transmembrane protein 218 (TMEM218), transcript variant 5


  "NM_001258238" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TMEM218"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TMEM218
Vector pCMV6-Entry
Sequence Data
>SC332596 representing NM_001258238.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGGCACTGTGCTCGGAGTCGGTGCGGGCGTGTTCATCTTAGCCCTGCTCTGGGTGGCAGTGCTG
CTGCTGTGTGTGCTGCTGTCCAGAGCCTCCGGGGCGGCGAGGTTCTCTGTCATTTTTTTATTCTTCGGT
GCTGTGATCATCACATCAGTTCTGTTGCTTTTCCCGCGAGCTGGTGAATTCCCAGCCCCAGAAGTGGAA
GTTAAGATTGTGGATGACTTTTTCATTGGCCGCTATGTCCTGCTGGCTTTCCTTAGTGCCATCTTCCTT
GGAGGCCTCTTCTTGGTTTTAATCCATTATGTTCTGGAGCCGATCTATGCCAAACCACTGCACTCCTAC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001258238
Insert Size 348 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258238.1
RefSeq Size 3915 bp
RefSeq ORF 348 bp
Locus ID 219854
UniProt ID A2RU14
Cytogenetics 11q24.2
Protein Families Transmembrane
MW 12.5 kDa
Gene Summary May be involved in ciliary biogenesis or function.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon. The encoded protein (isoform 2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.