Aurora B (AURKB) (NM_001256834) Human Untagged Clone

CAT#: SC332487

AURKB (untagged) - Homo sapiens aurora kinase B (AURKB), transcript variant 2


  "NM_001256834" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit polyclonal Aurora B pT232 antibody
    • 100 ug

USD 765.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Aurora B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Aurora B
Synonyms AIK2; AIM-1; AIM1; ARK-2; ARK2; AurB; aurkb-sv1; aurkb-sv2; IPL1; PPP1R48; STK-1; STK5; STK12
Vector pCMV6-Entry
Sequence Data
>SC332487 representing NM_001256834.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCCGCTCCAATGTCCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGCAGTGGGACA
CCCGACATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAG
TTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAG
TCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCAC
CATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTAT
GCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACG
ATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAG
CCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCG
CCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGC
ATGCACAATGAGAAGGTGGATCTGTGGTGCATTGGAGTGCTTTGCTATGAGCTGCTGGTGGGGAACCCA
CCCTTTGAGAGTGCATCACACAACGAGACCTATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCT
TCCGTGCCCATGGGAGCCCAGGACCTCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCC
CTGGCCCAGGTCTCAGCCCACCCTTGGGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTT
CAATCTGTCGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256834
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256834.1
RefSeq Size 1224 bp
RefSeq ORF 912 bp
Locus ID 9212
UniProt ID Q96GD4
Cytogenetics 17p13.1
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
MW 34.8 kDa
Gene Summary This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region, which results in translation initiation from an in-frame downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 5 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.