Cell adhesion molecule 2 (CADM2) (NM_001256502) Human Untagged Clone

CAT#: SC332402

CADM2 (untagged) - Homo sapiens cell adhesion molecule 2 (CADM2), transcript variant 4


  "NM_001256502" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cell adhesion molecule 2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Cell adhesion molecule 2
Synonyms IGSF4D; Necl-3; NECL3; SynCAM 2; synCAM2
Vector pCMV6-Entry
Sequence Data
>SC332402 representing NM_001256502.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCTGTCAAAACTTCCAAGGCATATCTCACCGTTCTGGGTGTTCCTGAAAAGCCTCAGATTAGTGGA
TTCTCATCACCAGTTATGGAGGGTGACTTGATGCAGCTGACTTGCAAAACATCTGGTAGTAAACCTGCA
GCTGATATAAGATGGTTCAAAAATGACAAAGAGATTAAAGATGTAAAATATTTAAAAGAAGAGGATGCA
AATCGCAAGACATTCACTGTCAGCAGCACACTGGACTTCCGAGTGGACCGGAGTGATGATGGAGTGGCG
GTCATCTGCAGAGTAGATCACGAATCCCTCAATGCCACCCCTCAGGTAGCCATGCAGGTGCTAGAAATA
CACTATACACCATCAGTTAAGATTATACCATCGACTCCTTTTCCACAAGAAGGACAGCCTTTAATTTTG
ACTTGTGAATCCAAAGGAAAACCACTGCCAGAACCTGTTTTGTGGACAAAGGATGGCGGAGAATTACCA
GATCCTGACCGAATGGTTGTGAGTGGTAGGGAGCTAAACATTCTTTTCCTGAACAAAACGGATAATGGT
ACATATCGATGTGAAGCCACAAACACCATTGGCCAAAGCAGTGCGGAATATGTTCTCATTGTGCATGAT
GTTCCCAACACTTTGCTTCCCACTACTATCATCCCCTCCCTTACCACTGCAACAGTCACAACCACTGTA
GCCATAACAACCAGCCCAACCACATCTGCAACAACCAGCAGCATCAGAGATCCTAATGCTTTGGCTGGC
CAGAATGGCCCTGACCATGCTCTCATAGGAGGAATAGTGGCTGTAGTTGTATTTGTCACGCTGTGTTCT
ATCTTTCTGCTTGGTCGATATCTGGCAAGGCATAAAGGAACGTATTTAACAAATGAAGCTAAAGGAGCT
GAAGATGCACCAGATGCTGATACAGCCATTATCAATGCTGAAGGCAGCCAAGTCAATGCTGAAGAGAAA
AAAGAGTATTTCATTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256502
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256502.1
RefSeq Size 9127 bp
RefSeq ORF 984 bp
Locus ID 253559
UniProt ID Q8N3J6
Cytogenetics 3p12.1
Protein Families Druggable Genome, Transmembrane
MW 35.4 kDa
Gene Summary This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (4) differs in the 5' UTR and coding region and uses a downstream start codon compared to variant 1. The resulting protein (isoform 4) is shorter and has a shorter N-terminus compared to isoform 1. Variants 4 and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.