Prostaglandin dehydrogenase 1 (HPGD) (NM_001256301) Human Untagged Clone

CAT#: SC332337

HPGD (untagged) - Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), transcript variant 3


  "NM_001256301" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
HPGD (Prostaglandin dehydrogenase 1) mouse monoclonal antibody, clone OTI2C10 (formerly 2C10)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Prostaglandin dehydrogenase 1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Prostaglandin dehydrogenase 1
Synonyms 15-PGDH; PGDH; PGDH1; PHOAR1; SDR36C1
Vector pCMV6-Entry
Sequence Data
>SC332337 representing NM_001256301.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGTAAGCAAAATGGAGGTGAAGGCGGCATCATTATCAATATGTCATCTTTAGCAGGACTCATGCCC
GTTGCACAGCAGCCGGTTTATTGTGCTTCAAAGCATGGCATAGTTGGATTCACACGCTCAGCAGCGTTG
GCTGCTAATCTTATGAACAGTGGTGTGAGACTGAATGCCATTTGTCCAGGCTTTGTTAACACAGCCATC
CTTGAATCAATTGAAAAAGAAGAAAACATGGGACAATATATAGAATATAAGGATCATATCAAGGATATG
ATTAAATACTATGGAATTTTGGACCCACCATTGATTGCCAATGGATTGATAACACTCATTGAAGATGAT
GCTTTAAATGGTGCTATTATGAAGATCACAACTTCTAAGGGAATTCATTTTCAAGACTATGATACAACT
CCATTTCAAGCAAAAACCCAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001256301
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256301.1
RefSeq Size 2774 bp
RefSeq ORF 438 bp
Locus ID 3248
UniProt ID P15428
Cytogenetics 4q34.1
Protein Families Druggable Genome
MW 15.7 kDa
Gene Summary This gene encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences result in translation at a downstream start codon and an isoform (3) with a shorter N-terminus, compared to isoform 1. Variants 3 and 6 encode the same protein (isoform 3).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.