Protein Z (PROZ) (NM_001256134) Human Untagged Clone

CAT#: SC332303

PROZ (untagged) - Homo sapiens protein Z, vitamin K-dependent plasma glycoprotein (PROZ), transcript variant 1


  "NM_001256134" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Protein Z"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Protein Z
Synonyms PZ
Vector pCMV6-Entry
Sequence Data
>SC332303 representing NM_001256134.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGGCTGCGTCCCACTGCTCCAGGGCCTGGTCCTGGTCCTCGCCCTCCATCGTGTGGAGCCCTCA
GCCACTTCACTGAAGGAACGACATGGACTCCATTCTGACTCTGCCTGCACAGGCGTCCAGGAAAGCTTA
TTTCTCCCGGCCTCCAAAGCAAACGACGTTCTGGTGAGGTGGAAGCGTGCGGGCTCCTATCTTCTGGAA
GAACTCTTCGAGGGAAACTTGGAAAAAGAATGTTATGAAGAAATCTGTGTCTATGAAGAAGCAAGAGAA
GTGTTTGAAAATGAAGTAGTCACTGATGAATTCTGGAGACGATATAAGGGCGGCTCCCCGTGCATCTCC
CAGCCCTGCCTCCACAACGGCTCTTGCCAGGACAGCATCTGGGGCTACACCTGCACCTGCTCCCCCGGC
TATGAGGGCAGCAACTGCGAGCTGGCTAAAAATGAATGTCACCCAGAGCGGACTGATGGGTGTCAACAC
TTCTGCCTCCCAGGACAGGAATCCTACACGTGCAGCTGTGCTCAGGGCTACAGGCTTGGTGAGGACCAC
AAACAGTGTGTGCCCCACGACCAGTGTGCCTGCGGGGTGCTGACCTCTGAGAAGCGTGCACCGGATCTA
CAGGACCTCCCGTGGCAGGTAAAGTTAACAAATTCCGAAGGAAAAGACTTCTGTGGTGGTGTTATAATA
CGGGAAAATTTTGTACTGACAACAGCAAAATGTTCACTGTTACACAGGAATATTACTGTAAAAACATAT
TTTAACAGAACGAGCCAAGACCCGCTGATGATCAAGATAACGCACGTCCATGTGCACATGCGGTATGAC
GCGGACGCGGGGGAGAATGACCTGTCACTGCTGGAGCTGGAGTGGCCCATCCAGTGCCCAGGTGCGGGG
CTCCCCGTGTGCACCCCTGAGAAAGACTTCGCTGAGCACCTCCTCATCCCACGCACCAGGGGCCTCCTC
AGCGGCTGGGCACGCAATGGCACTGACCTGGGCAACTCGCTGACCACGCGGCCTGTCACACTTGTGGAG
GGGGAGGAGTGCGGGCAGGTCCTGAATGTGACTGTCACCACCAGGACCTACTGTGAGAGAAGCAGCGTG
GCGGCCATGCACTGGATGGATGGAAGTGTGGTCACCAGAGAACACAGAGGCTCCTGGTTTCTCACGGGG
GTCCTGGGCTCGCAGCCAGTAGGAGGGCAGGCTCACATGGTCCTTGTCACCAAGGTCTCCAGGTACTCA
CTCTGGTTTAAACAGATCATGAACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001256134
Insert Size 1269 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256134.1
RefSeq Size 1555 bp
RefSeq ORF 1269 bp
Locus ID 8858
UniProt ID P22891
Cytogenetics 13q34
Protein Families Druggable Genome, Protease, Secreted Protein
MW 47.1 kDa
Gene Summary This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.