TRDN (NM_001256021) Human Untagged Clone

CAT#: SC332285

TRDN (untagged) - Homo sapiens triadin (TRDN), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TRDN
• Synonyms: CPVT5; TDN; TRISK
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332285 representing NM_001256021.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGACTGAGATCACTGCTGAAGGAAATGCATCTACAACCACAACTGTGATAGACAGCAAAAATGGATCT
  GTGCCCAAATCCCCCGGAAAAGTGCTGAAGAGGACAGTCACAGAAGACATAGTGACGACGTTCAGCTCC
  CCTGCAGCCTGGCTTCTGGTCATTGCCCTGATAATCACGTGGTCAGCTGTTGCCATCGTTATGTTTGAT
  TTAGTGGATTACAAAAACTTTTCAGCAAGCTCTATTGCCAAGATTGGCTCAGATCCTTTAAAACTGGTA
  CGTGATGCTATGGAGGAAACCACGGACTGGATCTATGGCTTCTTTTCTTTGTTATCTGACATCATCTCA
  TCTGAAGATGAAGAAGATGATGATGGTGACGAAGATACTGATAAAGGAGAAATAGATGAGCCTCCCTTG
  AGAAAAAAAGAAATACACAAAGATAAGACTGAAAAACAAGAGAAACCTGAAAGGAAAATACAAACTAAA
  GTTACACACAAAGAAAAAGAAAAAGGAAAAGAAAAAGTAAGAGAAAAAGAAAAACCTGAAAAGAAAGCA
  ACTCACAAGGAAAAAATTGAGAAAAAAGAAAAACCAGAAACAAAGACACTGGCGAAAGAACAGAAGAAA
  GCTAAGACTGCAGAAAAGAGTGAAGAAAAGACTAAAAAGGAAGTGAAAGGTGGAAAACAGGAGAAAGTG
  AAGCAAACAGCTGCAAAAGTAAAAGAAGTACAGAAAACACCATCAAAACCCAAAGAAAAGGAGGACAAA
  GAGAAAGCAGCTGTGTCAAAGCATGAACAGAAAGGTAAACATTCAGAGCAGGAGGCTGCCGGAGGTTCT
  AAGAGAATATTGGGCAAGAAGCACATGCAGTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256021
• Insert Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256021.1
• RefSeq Size: 3002 bp
• RefSeq ORF: 861 bp
• Locus ID: 10345
• Cytogenetics: 6q22.31
• Protein Families: Transmembrane
• MW: 32.1 kDa
• Gene Summary: This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (4) lacks several 3' exons but contains an alternate 3' end, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4, also known as Trisk 32) has a distinct and significantly shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.