SPAG6 (NM_001253854) Human Untagged Clone

CAT#: SC332245

SPAG6 (untagged) - Homo sapiens sperm associated antigen 6 (SPAG6), transcript variant 3


  "NM_001253854" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-SPAG6 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SPAG6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPAG6
Synonyms CFAP194; CT141; FAP194; pf16; Repro-SA-1
Vector pCMV6-Entry
Sequence Data
>SC332245 representing NM_001253854.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCATTCACTCACCATGGATCTCTGGATACCTAATGGACAGGCAGGTGTAATGTCTTTGCTGAGAACT
CTTCTTCTGGACGTGGTCCCAACAATTCAACAGACTGCTGCTTTGGCTCTTGGGAGACTGGCCAATTAT
AATGATGACCTAGCAGAAGCTGTTGTGAAGTGCGACATTCTTCCACAGCTTGTTTATTCATTGGCAGAA
CAGAATCGCTTCTACAAGAAAGCAGCTGCCTTTGTGTTACGAGCAGTTGGTAAACATTCTCCCCAGCTA
GCTCAGGCAATAGTCGATTGTGGAGCACTGGATACGCTGGTCATATGCTTGGAAGATTTTGACCCTGGA
GTCAAGGAGGCTGCAGCCTGGGCACTTAGATATATTGCAAGACATAATGCAGAACTGTCACAAGCTGTG
GTGGATGCAGGAGCTGTTCCTCTTTTAGTACTCTGTATCCAGGAGCCAGAAATTGCTTTGAAAAGGATT
GCTGCTTCGGCCCTCAGTGATATTGCAAAGCATTCTCCAGAGTTAGCACAGACAGTAGTGGATGCAGGA
GCTGTTGCTCATTTAGCCCAGATGATCCTGAACCCTGATGCTAAATTGAAGCATCAGATCCTTTCAGCT
CTCAGTCAGGTTTCAAAACATTCCGTGGATCTGGCAGAAATGGTTGTTGAAGCAGAGATTTTTCCAGTT
GTACTTACCTGTCTGAAGGACAAGGATGAATACGTGAAGAAAAATGCTTCTACTTTAATTAGAGAGATT
GCAAAACATACACCCGAGCTTTCACAGCTGGTAGTTAACGCAGGAGGGGTTGCTGCCGTGATTGACTGC
ATTGGGTCCTGCAAAGGGAACACACGGCTGCCTGGCATCATGATGCTTGGTTATGTAGCAGCTCATTCT
GAGAACCTAGCAATGGCAGTCATCATTTCTAAGGGTGTACCCCAGTTGTCAGTCTGCTTGTCAGAAGAA
CCGGAAGATCATATTAAGGCTGCAGCTGCTTGGGCCTTAGGACAGATTGGAAGACACACTCCTGAACAC
GCACGGGCTGTTGCAGTCACAAATACTTTGCCAGTTCTGCTTTCTTTGTACATGTCAACAGAAAGTTCT
GAGGATCTCCAAGTAAAAAGTAAAAAAGCCATAAAGAATATCCTGCAAAAATGTACCTACTTACCAGCC
CTTGAACCATTTCTATATGATGCTCCTCCCAATATTCTGAAACATGTGGTTGGACAGTTCAGTAAGGTG
CTGCCGCATGATAGCAAAGCTCGACGACTTTTTGTAACAAGTGGTGGCCTTAAAAAAGTTCAAGAGATA
AAAGCAGAACCTGGTTCTCTCCTTCAAGAATACATCAACAGTATTAACAGTTGTTACCCCGAGGAAATA
GTGAGGTATTATTCCCCTGGATATTCAGATACACTTCTGCAGAGGGTGGACAGCTATCAACCACTTAAT
AACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001253854
Insert Size 1455 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253854.1
RefSeq Size 2989 bp
RefSeq ORF 1455 bp
Locus ID 9576
UniProt ID O75602
Cytogenetics 10p12.2
MW 52.5 kDa
Gene Summary The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (3) contains several alternate exons in the 5' end that cause a frameshift and use of a downstream translation start site. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.