BBS4 (NM_001252678) Human Untagged Clone

CAT#: SC332212

BBS4 (untagged) - Homo sapiens Bardet-Biedl syndrome 4 (BBS4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BBS4
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC332212 representing NM_001252678.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCTGGGGAAGATCCACTTGCTGGAGGGAGACTTGGACAAGGCCATTGAAGTCTACAAGAAAGCAGTG
  GAGTTCTCACCAGAAAATACAGAGCTTCTTACAACTTTAGGATTACTCTACTTACAGCTCGGCATTTAC
  CAGAAGGCATTTGAACATCTTGGCAATGCACTGACTTATGACCCTACCAACTACAAGGCCATCTTGGCA
  GCAGGCAGCATGATGCAGACCCACGGGGACTTTGATGTTGCCCTCACCAAATACAGAGTTGTGGCTTGT
  GCTGTTCCAGAAAGTCCTCCACTCTGGAATAACATTGGAATGTGTTTCTTTGGCAAGAAGAAATATGTG
  GCGGCCATCAGCTGCCTGAAACGAGCCAACTACTTGGCACCCTTCGATTGGAAGATTCTGTATAATTTG
  GGCCTTGTCCATTTGACCATGCAGCAGTATGCATCAGCTTTTCATTTTCTCAGTGCGGCCATCAACTTC
  CAGCCAAAGATGGGGGAGCTCTACATGCTCTTGGCAGTGGCTCTGACCAATCTGGAAGATATAGAAAAT
  GCCAAGAGAGCCTACGCAGAAGCAGTCCACCTGGATAAGTGTAACCCTTTAGTAAACCTGAACTATGCT
  GTGCTGCTGTACAACCAGGGCGAGAAGAAGAACGCCCTGGCCCAATATCAGGAGATGGAGAAGAAAGTC
  AGCCTACTCAAGGACAATAGCTCTCTGGAATTTGACTCTGAGATGGTGGAGATGGCTCAGAAGTTGGGA
  GCTGCTCTCCAGGTTGGGGAGGCACTGGTCTGGACCAAACCAGTTAAAGATCCCAAATCAAAGCACCAG
  ACCACTTCAACCAGCAAACCTGCCAGTTTCCAGCAGCCTCTGGGCTCTAATCAAGCTCTAGGACAGGCA
  ATGTCTTCAGCAGCTGCATACAGGACGCTCCCCTCAGGTGCTGGAGGAACATCCCAGTTCACAAAGCCC
  CCATCTCTTCCTCTGGAGCCAGAGCCTGCGGTGGAATCAAGTCCAACTGAAACATCAGAACAAATAAGA
  GAGAAATAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252678
• Insert Size: 1044 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252678.1
• RefSeq Size: 2468 bp
• RefSeq ORF: 1044 bp
• Locus ID: 585
• UniProt ID: Q96RK4
• Cytogenetics: 15q24.1
• MW: 38.3 kDa
• Gene Summary: This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and cognitive disability. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
  Transcript Variant: This variant (2) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.