PLGF (PGF) (NM_001207012) Human Untagged Clone
CAT#: SC331735
PGF (untagged) - Homo sapiens placental growth factor (PGF), transcript variant 2
"NM_001207012" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "PLGF"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PLGF |
Synonyms | D12S1900; PGFL; PIGF; PLGF; PlGF-2; SHGC-10760 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331735 representing NM_001207012.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCGGTCATGAGGCTGTTCCCTTGCTTCCTGCAGCTCCTGGCCGGGCTGGCGCTGCCTGCTGTGCCC CCCCAGCAGTGGGCCTTGTCTGCTGGGAACGGCTCGTCAGAGGTGGAAGTGGTACCCTTCCAGGAAGTG TGGGGCCGCAGCTACTGCCGGGCGCTGGAGAGGCTGGTGGACGTCGTGTCCGAGTACCCCAGCGAGGTG GAGCACATGTTCAGCCCATCCTGTGTCTCCCTGCTGCGCTGCACCGGCTGCTGCGGCGATGAGAATCTG CACTGTGTGCCGGTGGAGACGGCCAATGTCACCATGCAGCTCCTAAAGATCCGTTCTGGGGACCGGCCC TCCTACGTGGAGCTGACGTTCTCTCAGCACGTTCGCTGCGAATGCCGGCCTCTGCGGGAGAAGATGAAG CCGGAAAGGTGCGGCGATGCTGTTCCCCGGAGGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001207012 |
Insert Size | 450 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001207012.1 |
RefSeq Size | 1848 bp |
RefSeq ORF | 450 bp |
Locus ID | 5228 |
UniProt ID | P49763 |
Cytogenetics | 14q24.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Bladder cancer, Focal adhesion, mTOR signaling pathway, Pancreatic cancer, Pathways in cancer, Renal cell carcinoma |
MW | 16.7 kDa |
Gene Summary | This gene encodes a growth factor found in placenta which is homologous to vascular endothelial growth factor. Alternatively spliced transcripts encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011] Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.