CCPG1 (NM_001204451) Human Untagged Clone

CAT#: SC331588

CCPG1 (untagged) - Homo sapiens cell cycle progression 1 (CCPG1), transcript variant 4


  "NM_001204451" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-CCPG1 Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CCPG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCPG1
Synonyms CPR8
Vector pCMV6-Entry
Sequence Data
>SC331588 representing NM_001204451.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGAAAATTCCAGTGACAGTGATTCATCTTGTGGTTGGACTGTCATCAGTCATGAGGGGTCAGAT
ATAGAAATGTTGAATTCTGTGACCCCCACTGACAGCTGTGAGCCCGCCCCAGAATGTTCATCTTTAGAG
CAAGAGGAGCTTCAAGCATTGCAGATAGAGCAAGGAGAAAGCAGCCAAAATGGCACAGTGCTTATGGAA
GAAACTGCTTATCCAGCTTTGGAGGAAACCAGCTCAACAATTGAGGCAGAGGAACAAAAGATACCCGAA
GACAGTATCTATATTGGAACTGCCAGTGATGATTCTGATATTGTTACCCTTGAGCCACCTAAGTTAGAA
GAAATTGGAAATCAAGAAGTTGTCATTGTTGAAGAAGCACAGAGTTCAGAAGACTTTAACATGGGCTCT
TCCTCTAGCAGCCAGTATACTTTCTGTCAGCCAGAAACTGTATTTTCATCTCAGCCTAGTGACGATGAA
TCAAGTAGTGATGAAACCAGTAATCAGCCCAGTCCTGCCTTTAGACGACGCCGTGCTAGGAAGAAGACC
GTTTCTGCTTCAGAATCTGAAGACCGGCTAGTTGCTGAACAAGAAACTGAACCTTCTAAGGAGTTGAGT
AAACGTCAGTTCAGTAGTGGTCTCAATAAGTGTGTTATACTTGCTTTGGTGATTGCAATCAGCATGGGA
TTTGGCCATTTCTATGGCACAATTCAGATTCAGAAGCGTCAACAGTTAGTCAGAAAGATACATGAAGAT
GAATTGAATGATATGAAGGATTATCTTTCCCAGTGTCAACAGGAACAAGAATCTTTTATAGATTATAAG
TCATTGAAAGAAAATCTTGCAAGGTGTTGGACACTTACTGAAGCAGAGAAGATGTCCTTTGAAACTCAG
AAAACGAACCTTGCTACAGAAAATCAGTATTTAAGAAAGCTCTTCACTGACTTTGTTAATGATGTTAAA
GATTATCTTAGAAACATGAAGGAATATGAAGTAGATAATGATGGAGTATTTGAGAAGTTGGATGAATAT
ATATATAGACACTTCTTTGGTCACACTTTTTCCCCTCCATATGGACCCAGTCGACCTGATAAAAAGCAA
CGTATGGTAAATATTGAAAACTCCAGGCATCGAAAACAAGAGCAGAAGCACCTTCAGCCACAGCCTTAT
AAAAGGGAAGGTAAATGGCATAAATATGGTCGCACTAATGGAAGACAAATGGCAAATCTTGAAATAGAA
TTGGGGCAATTACCTTTTGATCCTCAATACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204451
Insert Size 1275 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204451.1
RefSeq Size 2571 bp
RefSeq ORF 1275 bp
Locus ID 9236
UniProt ID Q9ULG6
Cytogenetics 15q21.3
Protein Families Transmembrane
MW 48.6 kDa
Gene Summary Acts as an assembly platform for Rho protein signaling complexes. Limits guanine nucleotide exchange activity of MCF2L toward RHOA, which results in an inhibition of both its transcriptional activation ability and its transforming activity. Does not inhibit activity of MCF2L toward CDC42, or activity of MCF2 toward either RHOA or CDC42 (By similarity). May be involved in cell cycle regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two segments in the 3' coding region, one of which causes a frameshift. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.