RGS6 (NM_001204419) Human Untagged Clone

CAT#: SC331579

RGS6 (untagged) - Homo sapiens regulator of G-protein signaling 6 (RGS6), transcript variant 5


  "NM_001204419" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


RGS6 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "RGS6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RGS6
Synonyms GAP; HA117; S914
Vector pCMV6-Entry
Sequence Data
>SC331579 representing NM_001204419.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCAAGGATCCGGGGATCAAAGAGCAGTGGGGGTTGCTGACCCAGAGGAGAGTTCTCCAAACATG
ATCGTTTACTGCAAAATTGAAGACATCATTACAAAGATGCAAGATGACAAGACAGGGGGTGTGCCCATC
AGAACAGTCAAGAGCTTTCTCTCCAAAATCCCCAGTGTCGTCACAGGTACTGACATTGTGCAGTGGCTT
ATGAAGAACCTTTCCATTGAGGACCCAGTTGAAGCAATACACTTGGGGAGCCTTATCGCTGCCCAGGGC
TACATCTTTCCAATCTCAGACCATGTTCTCACCATGAAGGATGATGGCACCTTTTATCGTTTCCAGGCT
CCGTACTTCTGGCCTTCGAACTGCTGGGAACCTGAAAACACTGACTATGCCATCTATCTCTGTAAGAGG
ACAATGCAAAATAAAGCAAGGCTGGAACTGGCAGATTATGAAGCAGAAAACTTAGCAAGACTCCAGAGG
GCCTTTGCGAGGAAGTGGGAATTCATCTTTATGCAAGCAGAAGCACAAGTAAAGATTGACCGGAAAAAA
GACAAGACAGAAAGGAAAATTTTGGATAGTCAAGAACGAGCCTTTTGGGATGTCCACAGGCCTGTGCCA
GGCTGTGTGAACACAACAGAAATGGATATCCGAAAATGTCGACGTTTGAAGAATCCACAAAAGGTTAAA
AAGTCCGTGTATGGCGTGACTGAAGAGTCCCAGGCACAGAGCCCGGTGCATGTACTCAGCCAACCAATC
AGGAAAACAACAAAAGAGGACATCCGGAAACAGATAACATTTTTGAACGCACAGATCGACAGACATTGT
TTGAAAATGTCCAAAGTGGCTGAAAGCAAAGAGCCCAGCCAACAGCGAGTAAAAAGATGGGGCTTCTCT
TTCGATGAGATATTGAAGGACCAGGTGGGGCGGGACCAGTTTCTACGATTCCTGGAGTCCGAATTCAGT
TCAGAAAACCTCAGGTTCTGGCTGGCTGTCCAAGATCTTAAGAAACAACCCCTACAGGATGTGGCCAAG
AGGGTAGAAGAAATCTGGCAAGAGTTTCTGGCTCCAGGGGCTCCAAGTGCAATCAACCTGGATTCTCAC
AGCTATGAGATAACCAGTCAAAATGTCAAAGATGGAGGGAGATATACATTTGAAGACGCCCAGGAGCAC
ATCTACAAGCTGATGAAGAGTGACAGCTATGCCCGCTTCCTCCGGTCAAATGCTTACCAGGATTTGCTG
CTGGCCAAGAAGAAGCCAGAAAGTGAGCAAGGTCGTAGAACTTCCCTAGAAAAGTTCACTCGCAGTGTG
GGAAAGTCGCTGGCGGGCAAGCGCCTCACGGGCCTGATGCAGTCCTCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001204419
Insert Size 1362 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204419.1
RefSeq Size 5693 bp
RefSeq ORF 1362 bp
Locus ID 9628
UniProt ID P49758
Cytogenetics 14q24.2
Protein Families Druggable Genome
MW 52.2 kDa
Gene Summary This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP and GGL domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Many alternatively spliced transcript variants encoding different isoforms with long or short N-terminal domains, complete or incomplete GGL domains, and distinct C-terminal domains, have been described for this gene, however, the full-length nature of some of these variants is not known.[provided by RefSeq, Mar 2011]
Transcript Variant: This variant (5) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (5, also known as RGS6Lalpha1(-GGL)) missing a segment of the GGL domain, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.