TTYH1 (NM_001201461) Human Untagged Clone

CAT#: SC331427

TTYH1 (untagged) - Homo sapiens tweety family member 1 (TTYH1), transcript variant 3


  "NM_001201461" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal TTYH1 Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "TTYH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TTYH1
Vector pCMV6-Entry
Sequence Data
>SC331427 representing NM_001201461.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGCGCCCCCGGGCTACCGGCCCTCAGCTTGGGTGCATCTCCTCCACCAGCTGCCCCGCGCCGAC
TTCCAGCTCCGCCCGGTGCCCAGCGTTTTCGCGCCCCAAGAGCAGGAATACCAGCAGGCCTTGTTGCTG
GTGGCGGCCTTGGCGGGCCTGGGCTTGGGCCTGAGCCTCATTTTCATCGCTGTCTACCTCATCCGCTTC
TGCTGCTGCCGGCCCCCCGAGCCCCCCGGGTCCAAGATCCCCTCGCCCGGGGGAGGCTGCGTCACCTGG
AGCTGCATTGTCGCCCTTCTCGCCGGCTGCACTGGCATTGGCATCGGTTTCTATGGCAACAGTGAGACC
AGTGATGGGGTGTCCCAGCTCAGCTCTGCGCTGCTGCACGCCAACCACACACTCAGCACCATTGACCAC
CTGGTGTTGGAGACGGTGGAGAGGCTGGGCGAGGCGGTGAGGACAGAGCTGACCACCCTGGAGGAGGTG
CTCGAGCCGCGCACGGAGCTGGTGGCTGCCGCCCGAGGGGCTCGACGGCAGGCGGAGGCTGCGGCCCAG
CAGCTGCAGGGGCTGGCCTTCTGGCAGGGAGTGCCCCTGAGCCCCCTGCAGGTGGCTGAAAATGTGTCC
TTTGTGGAGGAGTACAGGTGGCTGGCCTACGTCCTCCTGCTGCTCCTGGAGCTGCTGGTCTGCCTCTTC
ACCCTCCTGGGCCTGGCGAAGCAGAGCAAGTGGCTGGTGATCGTGATGACAGTCATGAGTCTCCTGGTT
CTCGTCCTGAGCTGGGGCTCCATGGGCCTGGAGGCAGCCACGGCCGTGGGCCTCAGTGACTTCTGCTCC
AATCCAGACCCTTATGTTCTGAACCTGACCCAGGAGGAGACAGGGCTCAGCTCAGACATCCTGAGCTAT
TATCTCCTCTGCAACCGGGCCGTCTCCAACCCCTTCCAACAGAGGCTGACTCTGTCCCAGCGAGCTCTG
GCCAACATCCACTCCCAGCTGCTGGGCCTGGAGCGAGAAGCTGTGCCTCAGTTCCCTTCAGCGCAGAAG
CCTCTGCTGTCCTTGGAGGAGACTCTGAATGTGACAGAAGGAAATTTCCACCAGTTGGTGGCACTGCTA
CACTGCCGCAGCCTGCACAAGGACTATGGTGCAGCCCTGCGGGGCCTGTGCGAAGACGCCCTGGAAGGC
CTGCTCTTCCTGCTACTCTTCTCCCTGCTGTCTGCAGGAGCGCTGGCCACTGCCCTCTGCAGCCTGCCC
CGAGCCTGGGCCCTCTTCCCACCCAGTGACGACTACGATGACACAGACGATGACGACCCTTTCAACCCT
CAGCAGGAATCCAAGCGCTTTGTGCAGTGGCAGTCGTCTATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001201461
Insert Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001201461.1
RefSeq Size 1924 bp
RefSeq ORF 1356 bp
Locus ID 57348
UniProt ID Q9H313
Cytogenetics 19q13.42
Protein Families Ion Channels: Other, Transmembrane
MW 49.2 kDa
Gene Summary This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-independent, volume-sensitive large conductance chloride(-) channel. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3) uses an alternate in-frame splice junction at the 5' end of an exon and contains an alternate exon compared to variant 2, that causes a frameshift. The resulting isoform (1) has a shorter and distinct C-terminus compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.