UQCRB (NM_001199975) Human Untagged Clone

CAT#: SC331394

UQCRB (untagged) - Homo sapiens ubiquinol-cytochrome c reductase binding protein (UQCRB), transcript variant 2


  "NM_001199975" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Complex III Subunit 7 Rabbit monoclonal Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "UQCRB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UQCRB
Synonyms MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC
Vector pCMV6-Entry
Sequence Data
>SC331394 representing NM_001199975.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGAGATGATACAATATACGAGGATGAAGATGTAAAAGAAGCCATAAGAAGACTTCCTGAGAACCTT
TATAATGACAGGATGTTTCGCATTAAGAGGGCACTGGACCTGAACTTGAAGCATCAGATCTTGCCTAAA
GAGCAGTGGACCAAATATGAAGAGGAAAATTTCTACCTTGAACCGTATCTGAAAGAGGTTATTCGGGAA
AGAAAAGAAAGAGAAGAATGGGCAAAGAAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199975
Insert Size 240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199975.2
RefSeq Size 4953 bp
RefSeq ORF 240 bp
Locus ID 7381
UniProt ID P14927
Cytogenetics 8q22.1
Protein Pathways Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
MW 10 kDa
Gene Summary This gene encodes a subunit of the ubiquinol-cytochrome c oxidoreductase complex, which consists of one mitochondrial-encoded and 10 nuclear-encoded subunits. The protein encoded by this gene binds ubiquinone and participates in the transfer of electrons when ubiquinone is bound. This protein plays an important role in hypoxia-induced angiogenesis through mitochondrial reactive oxygen species-mediated signaling. Mutations in this gene are associated with mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. Related pseudogenes have been identified on chromosomes 1, 5 and X. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) has an additional exon in its 5' UTR, which results in the use of a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.