SNX10 (NM_001199837) Human Untagged Clone
CAT#: SC331377
SNX10 (untagged) - Homo sapiens sorting nexin 10 (SNX10), transcript variant 3
"NM_001199837" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "SNX10"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SNX10 |
Synonyms | OPTB8 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331377 representing NM_001199837.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATGCCATTACAGGAATTTGTAAGTGTCTGGGTTCGAGATCCTAGGATTCAGAAGGAGGACTTCTGG CATTCTTACATTGACTATGAGATATGTATTCATACTAATAGCATGTGTTTTACAATGAAAACATCCTGT GTACGAAGAAGATATAGAGAATTCGTGTGGCTGAGGCAGAGACTCCAAAGTAATGCGTTGCTGGTACAA CTGCCAGAACTTCCATCTAAAAACCTGTTTTTCAACATGAACAATCGCCAGCACGTGGATCAGCGTCGC CAGGGTCTGGAAGATTTCCTCAGAAAAGTCCTACAGAATGCACTTTTGCTTTCAGATAGCAGCCTTCAC CTCTTCTTACAGAGCCATCTGAATTCAGAAGACATTGAGGCGTGTGTTTCTGGGCAGACTAAGTACTCT GTGGAAGAAGCAATTCACAAGTTTGCCTTAATGAATAGACGTTTCCCTGAAGAAGATGAAGAAGGAAAA AAAGAAAATGATATAGATTATGATTCAGAAAGTTCATCCTCTGGGCTTGGACACAGTAGTGATGACAGC AGTTCACATGGATGTAAAGTAAATACAGCTCCGCAGGAATCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199837 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199837.1 |
RefSeq Size | 2443 bp |
RefSeq ORF | 597 bp |
Locus ID | 29887 |
UniProt ID | Q9Y5X0 |
Cytogenetics | 7p15.2 |
MW | 23.2 kDa |
Gene Summary | This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. This gene may play a role in regulating endosome homeostasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (3) has a distinct 5' UTR, compared to variant 1, which results in the use of a distinct translation initiation signal. It encodes a shorter isoform (2) with a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.