PTPN7 (NM_001199797) Human Untagged Clone

CAT#: SC331363

PTPN7 (untagged) - Homo sapiens protein tyrosine phosphatase, non-receptor type 7 (PTPN7), transcript variant 3


  "NM_001199797" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PTPN7 (HePTP) mouse monoclonal antibody, clone OTI3B10 (formerly 3B10)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PTPN7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PTPN7
Synonyms BPTP-4; HEPTP; LC-PTP; LPTP; PTPNI
Vector pCMV6-Entry
Sequence Data
>SC331363 representing NM_001199797.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACCGGCTGGGCTGCTGGCCCGCAAGGAGCCTGCCAAGGTCAGGCAGGGGCAGTGGGCAGAGGAGT
CTTGGACTTGGGGGCCACCCTTCAGGTCCCAGGCATCCAGGCACCCCAGCAGCGAAGAGGACATGGGAG
TCCCCTGGTGTGAGGGCCAGAGACTGTCCACTGTCTACCTCATGGCTGAGTGAGCCTCCCCTGGGCCCA
GCACCCCACCTCAGCATGGTCCAAGCCCATGGGGGGCGCTCCAGAGCACAGCCGTTGACCTTGTCTTTG
GGGGCAGCCATGACCCAGCCTCCGCCTGAAAAAACGCCAGCCAAGAAGCATGTGCGACTGCAGGAGAGG
CGGGGCTCCAATGTGGCTCTGATGCTGGACGTTCGGTCCCTGGGGGCCGTAGAACCCATCTGCTCTGTG
AACACACCCCGGGAGGTCACCCTACACTTTCTGCGCACTGCTGGACACCCCCTTACCCGCTGGGCCCTT
CAGCGCCAGCCACCCAGCCCCAAGCAACTGGAAGAAGAATTCTTGAAGATCCCTTCAAACTTTGTCAGC
CCCGAAGACCTGGACATCCCTGGCCACGCCTCCAAGGACCGATACAAGACCATCTTGCCAAATCCCCAG
AGCCGTGTCTGTCTAGGCCGGGCACAGAGCCAGGAGGACGGAGATTACATCAATGCCAACTACATCCGA
GGCTATGACGGGAAGGAGAAGGTCTACATTGCCACCCAGGGCCCCATGCCCAACACTGTGTCGGACTTC
TGGGAGATGGTGTGGCAAGAGGAAGTGTCCCTCATTGTCATGCTCACTCAGCTCCGAGAGGGCAAGGAG
AAATGTGTCCACTACTGGCCCACAGAAGAGGAAACCTATGGACCCTTCCAGATCCGCATCCAGGACATG
AAAGAGTGCCCAGAATACACTGTGCGGCAGCTCACCATCCAGTACCAGGAAGAGCGCCGGTCAGTAAAG
CACATCCTCTTTTCGGCCTGGCCAGACCATCAGACACCAGAATCAGCTGGGCCCCTGCTGCGCCTAGTG
GCAGAGGTGGAGGAGAGCCCGGAGACAGCCGCCCACCCCGGGCCTATCGTAGTCCACTGCAGTGCAGGG
ATTGGCCGGACGGGCTGCTTCATCGCCACGCGAATTGGCTGTCAACAGCTGAAAGCCCGAGGAGAAGTG
GACATTCTGGGTATTGTGTGCCAACTGCGGCTAGACAGAGGGGGGATGATCCAGACGGCAGAGCAGTAC
CAGTTCCTGCACCACACTTTGGCCCTGTATGCAGGCCAGCTGCCTGAGGAACCCAGCCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199797
Insert Size 1305 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199797.1
RefSeq Size 2926 bp
RefSeq ORF 1305 bp
Locus ID 5778
Cytogenetics 1q32.1
Protein Families Druggable Genome, Phosphatase
Protein Pathways MAPK signaling pathway
MW 48.3 kDa
Gene Summary The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This gene is preferentially expressed in a variety of hematopoietic cells, and is an early response gene in lymphokine stimulated cells. The non-catalytic N-terminus of this PTP can interact with MAP kinases and suppress the MAP kinase activities. This PTP was shown to be involved in the regulation of T cell antigen receptor (TCR) signaling, which was thought to function through dephosphorylating the molecules related to MAP kinase pathway. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) lacks a segment in the 5' region, resulting in an upstream AUG start codon, as compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.