PACSIN1 (NM_001199583) Human Untagged Clone

CAT#: SC331329

PACSIN1 (untagged) - Homo sapiens protein kinase C and casein kinase substrate in neurons 1 (PACSIN1), transcript variant 2


  "NM_001199583" in other vectors (2)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Goat Polyclonal Antibody against PACSIN1
    • 100 ug

USD 520.00

Other products for "PACSIN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PACSIN1
Synonyms SDPI
Vector pCMV6-Entry
Sequence Data
>SC331329 representing NM_001199583.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCAGCTCCTACGATGAGGCCTCACTGGCGCCAGAGGAGACCACCGACAGCTTCTGGGAGGTGGGG
AACTACAAGCGGACCGTGAAGCGCATCGATGACGGCCACCGTCTATGCAACGACCTGATGAACTGCGTG
CAGGAGCGCGCCAAGATCGAGAAGGCGTACGGGCAGCAGCTCACCGACTGGGCCAAGCGTTGGCGCCAG
CTCATCGAGAAAGGCCCACAGTATGGCAGCCTGGAGCGGGCCTGGGGTGCCATAATGACAGAGGCAGAC
AAGGTGAGCGAGCTGCACCAGGAGGTGAAGAACAATCTGCTGAATGAGGACCTGGAGAAGGTGAAGAAC
TGGCAGAAGGACGCCTATCACAAGCAGATCATGGGTGGCTTCAAGGAGACGAAGGAGGCTGAAGATGGC
TTCCGCAAGGCCCAGAAGCCTTGGGCCAAGAAGATGAAGGAGCTGGAGGCAGCCAAGAAGGCCTACCAT
TTGGCTTGCAAAGAGGAAAAGCTGGCCATGACACGGGAGATGAACAGCAAGACGGAGCAATCGGTCACA
CCTGAGCAGCAAAAGAAGCTGCAGGACAAAGTGGACAAGTGCAAGCAGGATGTGCAGAAGACACAGGAG
AAGTATGAGAAAGTGCTGGAAGATGTGGGCAAGACCACACCCCAGTACATGGAGAACATGGAGCAGGTG
TTTGAGCAATGCCAGCAATTTGAGGAAAAGCGGCTGGTCTTCCTCAAGGAGGTGCTGCTGGACATCAAA
CGGCACCTCAACCTGGCTGAGAACAGCAGCTACATCCATGTGTACCGTGAGCTGGAGCAGGCCATCCGG
GGGGCTGATGCCCAGGAAGACCTCAGATGGTTCCGCAGCACCAGTGGCCCCGGCATGCCCATGAACTGG
CCCCAGTTTGAGGAGTGGAACCCAGACCTTCCTCACACCACCACCAAGAAGGAGAAACAGCCTAAGAAG
GCAGAGGGAGTGGCGCTGACCAATGCCACTGGGGCGGTAGAGTCCACATCCCAGGCTGGGGACCGCGGC
AGTGTTAGCAGCTACGACAGAGGCCAGCCCTACGCCACCGAGTGGTCAGACGACGAGAGTGGGAACCCC
TTTGGGGGCAGTGAGACCAACGGGGGCGCCAACCCCTTTGAGGACGACTCCAAGGGAGTGCGCGTGCGG
GCACTCTACGACTATGACGGCCAGGAGCAGGACGAGCTCAGCTTTAAGGCCGGAGACGAACTCACCAAG
CTGGGCGAGGAGGATGAGCAGGGCTGGTGCCGTGGGCGGCTGGACAGCGGGCAGCTGGGCCTCTACCCT
GCCAACTACGTGGAGGCTATCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199583
Insert Size 1335 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199583.2
RefSeq Size 4332 bp
RefSeq ORF 1335 bp
Locus ID 29993
UniProt ID Q9BY11
Cytogenetics 6p21.31
Protein Families Druggable Genome
MW 51 kDa
Gene Summary Plays a role in the reorganization of the microtubule cytoskeleton via its interaction with MAPT; this decreases microtubule stability and inhibits MAPT-induced microtubule polymerization. Plays a role in cellular transport processes by recruiting DNM1, DNM2 and DNM3 to membranes. Plays a role in the reorganization of the actin cytoskeleton and in neuron morphogenesis via its interaction with COBL and WASL, and by recruiting COBL to the cell cortex. Plays a role in the regulation of neurite formation, neurite branching and the regulation of neurite length. Required for normal synaptic vesicle endocytosis; this process retrieves previously released neurotransmitters to accommodate multiple cycles of neurotransmission. Required for normal excitatory and inhibitory synaptic transmission (By similarity). Binds to membranes via its F-BAR domain and mediates membrane tubulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an alternate 5' UTR exon and encodes the same protein as variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.