ProDynorphin (PDYN) (NM_001190898) Human Untagged Clone

CAT#: SC331141

PDYN (untagged) - Homo sapiens prodynorphin (PDYN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ProDynorphin
• Synonyms: ADCA; PENKB; SCA23
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC331141 representing NM_001190898.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCCTGGCAGGGGCTGGTCCTGGCTGCCTGCCTCCTCATGTTCCCCTCCACCACAGCGGACTGCCTG
  TCGCGGTGCTCCTTGTGTGCTGTAAAGACCCAGGATGGTCCCAAACCTATCAATCCCCTGATTTGCTCC
  CTGCAATGCCAGGCTGCCCTGCTGCCCTCTGAGGAATGGGAGAGATGCCAGAGCTTTCTGTCTTTTTTC
  ACCCCCTCCACCCTTGGGCTCAATGACAAGGAGGACTTGGGGAGCAAGTCGGTTGGGGAAGGGCCCTAC
  AGTGAGCTGGCCAAGCTCTCTGGGTCATTCCTGAAGGAGCTGGAGAAAAGCAAGTTTCTCCCAAGTATC
  TCAACAAAGGAGAACACTCTGAGCAAGAGCCTGGAGGAGAAGCTCAGGGGTCTCTCTGACGGGTTTAGG
  GAGGGAGCAGAGTCTGAGCTGATGAGGGATGCCCAGCTGAACGATGGTGCCATGGAGACTGGCACACTC
  TATCTCGCTGAGGAGGACCCCAAGGAGCAGGTCAAACGCTATGGGGGCTTTTTGCGCAAATACCCCAAG
  AGGAGCTCAGAGGTGGCTGGGGAGGGGGACGGGGATAGCATGGGCCATGAGGACCTGTACAAACGCTAT
  GGGGGCTTCTTGCGGCGCATTCGTCCCAAGCTCAAGTGGGACAACCAGAAGCGCTATGGCGGTTTTCTC
  CGGCGCCAGTTCAAGGTGGTGACTCGGTCTCAGGAAGATCCGAATGCTTACTCTGGAGAGCTTTTTGAT
  GCATAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001190898
• Insert Size: 765 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001190898.2
• RefSeq Size: 2797 bp
• RefSeq ORF: 765 bp
• Locus ID: 5173
• UniProt ID: P01213
• Cytogenetics: 20p13
• Protein Families: Secreted Protein
• MW: 28.4 kDa
• Gene Summary: The protein encoded by this gene is a preproprotein that is proteolytically processed to form the secreted opioid peptides beta-neoendorphin, dynorphin, leu-enkephalin, rimorphin, and leumorphin. These peptides are ligands for the kappa-type of opioid receptor. Dynorphin is involved in modulating responses to several psychoactive substances, including cocaine. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
  Transcript Variant: This variant (2) has an alternate splice site in the 5' UTR, which results in three nt less than variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.