Bcl rambo (BCL2L13) (NM_001270727) Human Untagged Clone

CAT#: SC331115

BCL2L13 (untagged) - Homo sapiens BCL2-like 13 (apoptosis facilitator) (BCL2L13), transcript variant 3


  "NM_001270727" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Bcl-rambo Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Bcl rambo"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Bcl rambo
Synonyms BCL-RAMBO; Bcl2-L-13; MIL1
Vector pCMV6-Entry
Sequence Data
>SC331115 representing NM_001270727.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCAGGTAGTTCAGGTCCCGCCCCGACGCCGGCCGTGACGAAGGCACGCCGGGGTGACCTCACCCTC
CAACATGGCGGCGGCGGTAGATTAGGGCCGCGGGTCGGAGCACTCACCGCCGCTGGGGGACCCTGTCGG
AAGCAACTGCCGCCGCCGCCTCTTTCATCTCTTCTGGGGCAGGGGCCAGGGCCAGGGGTTCAACTAGAT
ATAGCTTCACAATCTCTGGATCAAGAAATTTTATTAAAAGTTAAAACTGAAATTGAAGAAGAGCTAAAA
TCTCTGGACAAAGAAATTTCTGAAGCCTTCACCAGCACAGGCTTTGACCGTCACACTTCTCCAGTGTTC
AGCCCTGCCAATCCAGAAAGCTCAATGGAAGACTGCTTGGCCCATCTTGGAGAAAAAGTGTCCCAGGAA
CTGAAAGAGCCTCTCCATAAAGCATTGCAAATGCTCCTGAGCCAGCCAGTGACATATCAGGCATTTCGG
GAATGTACACTGGAGACCACAGTTCATGCCAGCGGCTGGAATAAGGGCACTGTGTTTAGTCTTGAGTCA
GAGGAGGAGGAATACCCTGGAATCACTGCAGAAGATAGCAATGACATTTACATCCTGCCCAGCGACAAC
TCTGGACAAGTCAGTCCCCCAGAGTCTCCAACTGTGACCACTTCCTGGCAGTCTGAGAGCTTACCTGTG
TCACTGTCAGCTAGCCAGAGTTGGCACACAGAAAGCCTGCCAGTGTCACTAGGCCCTGAGTCCTGGCAG
CAGATTGCAATGGATCCTGAAGAAGTGAAAAGCTTAGACAGCAACGGAGCTGGAGAGAAGAGTGAGAAC
AACTCCTCTAATTCTGACATTGTGCACGTGGAGAAAGAAGAGGTGCCCGAGGGCATGGAAGAGGCTGCT
GTGGCTTCTGTGGTCTTGCCAGCGCGGGAGCTGCAAGAGGCACTTCCTGAAGCCCCAGCTCCCTTGCTT
CCACATATCACTGCCACCTCCCTGCTGGGGACAAGGGAACCTGACACAGAAGTGATCACAGTTGAGAAA
TCCAGCCCTGCTACATCTCTGTTTGTAGAACTTGATGAAGAAGAGGTGAAAGCAGCAACAACTGAACCT
ACTGAAGTGGAGGAGGTGGTCCCCGCACTGGAACCCACAGAAACGCTGCTGAGTGAGAAGGAGATAAAC
GCAAGGGAAGAGAGCCTTGTGGAAGAGCTGTCCCCTGCCAGCGAGAAGAAGCCCGTGCCGCCGTCTGAG
GGCAAGTCTAGACTGTCCCCCGCCGGTGAGATGAAGCCCATGCCGCTGTCTGAGGGCAAGTCTATACTG
CTGTTTGGAGGGGCTGCTGCTGTTGCCATCCTGGCAGTGGCCATCGGGGTAGCCCTGGCTCTGAGAAAG
AAATAG

Restriction Sites SgfI-MluI     
ACCN NM_001270727
Insert Size 1386 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270727.1
RefSeq Size 4817 bp
RefSeq ORF 1386 bp
Locus ID 23786
Cytogenetics 22q11.21
Protein Families Druggable Genome, Transmembrane
MW 48.9 kDa
Gene Summary This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) lacks two exons in the coding region, and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (c) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.