CFAP410 (NM_001271441) Human Untagged Clone

CAT#: SC330935

C21orf2 (untagged) - Homo sapiens chromosome 21 open reading frame 2 (C21orf2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CFAP410
• Synonyms: C21orf2; LRRC76; RDMS; SMDAX; YF5/A2
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330935 representing NM_001271441.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAAGCTGACGCGGAAGATGGTTCTGACCCGGGCCAAGGCCTCGGAGCTGCACAGCGTGCGCAAGCTC
  AACTGCTGGGGCAGCCGCCTCACAGATATCTCCATTTGCCAGGAGATGCCCAGCCTGGAGGTGATCACG
  CTCAGTGTCAACAGCATCTCCACCCTGGAGCCTGTGAGCCGGTGCCAGCGCCTGAGTGAGCTGTACCTG
  CGGAGGAACCGCATCCCCAGCCTGGCTGAGCTCTTCTACCTGAAGGGGCTGCCGCGTCTGCGGGTGCTG
  TGGCTGGCCGAGAACCCGTGCTGCGGCACCAGCCCCCACCGCTACCGCATGACCGTGCTGCGCACCCTG
  CCGCGCCTACAGAAGCTGGACAACCAGGCTGTGACGGAGGAGGAGCTGTCCCGTGCACTGAGTGAGGGA
  GAGGAGATCACTGCGGCCCCAGAGAGAGAGGGCACAGGCCACGGCGGCCCCAAGCTATGCTGCACACTG
  AGCTCCCTCAGCTCCGCTGCTGAGACTGGCCGGGACCCGCTGGACAGCGAGGAGGAGGCAACCGGCGCC
  CAGGATGAACGTGGCCTGAAGCCGCCTTCCCGGGGCCAGTTTCCTTCCCTCTCAGCCAGGGATGCCTCG
  AGCAGCCACAGGGGCAGGGTGAGTGGCGGGCCGCTAGGGGCCGCGGCTGCCTCTGCCCACTGCACCCAC
  TGCACAGAAACCGTGGGGAGGGAGCATGGAGCCTCACAGGGCCCCGTGGGGAGGGAGCATGGAGCCTCA
  CAGGGCCTTGAAGAGCTGTGCCCCAGGGGGAGCTGCGTGTGCGGGTCTGTGAATGCGCACACACGTGTA
  ACACGTGCCCCGCACGGAGCCGTCCTGGCCCCTCAGCCTCTCCTGCTGTCCTGGTCTGTGGAATGTGGG
  CCCGGGCCCTGCTGGGCTGAGGGCAACAGGAGTCACGTGGAAGAGGTGCCACACACGCGTCCACAGGCG
  GGGCTCCTCTGCTCAGATTCTCCGAGTGTGCCGAACGTCCTGACTGCCATCCTGCTGCTGCTGCGGGAG
  CTGGATGCAGAGGGGCTGGAGGCCGTGCAGCAGACTGTGGGCAGCCGGCTGCAGGCCCTGCGTGGGGAA
  GAGGTGCAGGAGCACGCCGAGTGA
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001271441
• Insert Size: 1128 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001271441.1
• RefSeq Size: 2611 bp
• RefSeq ORF: 1128 bp
• Locus ID: 755
• UniProt ID: O43822
• Cytogenetics: 21q22.3
• MW: 40.4 kDa
• Gene Summary: Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]
  Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (3) has an additional segment in the C-terminal region, compared to isoform 1.