Bcl rambo (BCL2L13) (NM_001270734) Human Untagged Clone
CAT#: SC330873
BCL2L13 (untagged) - Homo sapiens BCL2-like 13 (apoptosis facilitator) (BCL2L13), transcript variant 10
"NM_001270734" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "Bcl rambo"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Bcl rambo |
Synonyms | BCL-RAMBO; Bcl2-L-13; MIL1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330873 representing NM_001270734.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGTCCTCTTCTACTGTGCCTCTGGGATTTCACTATGAAACAAAGTATGTTGTTCTCAGCTACTTG GGACTCCTCTCTCAAGAGAAGCTGCAAGAGCAACATCTTTCCTCACCCCAAGGGGTTCAACTAGATATA GCTTCACAATCTCTGGATCAAGAAATTTTATTAAAAGTTAAAACTGAAATTGAAGAAGAGCTAAAATCT CTGGACAAAGAAATTTCTGAAGCCTTCACCAGCACAGGCTTTGACCGTCACACTTCTCCAGTGTTCAGC CCTGCCAATCCAGAAAGCTCAATGGAAGACTGCTTGGCCCATCTTGGAGAAAAAGTGTCCCAGGAACTG AAAGAGCCTCTCCATAAAGCATTGCAAATGCTCCTGAGCCAGGCACTGTGTTTAGTCTTGAGTCAGAGG AGGAGGAATACCCTGGAATCACTGCAGAAGATAGCAATGACATTTACATCCTGCCCAGCGACAACTCTG GACAAGTCAGTCCCCCAGAGTCTCCAACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001270734 |
Insert Size | 516 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001270734.1 |
RefSeq Size | 4918 bp |
RefSeq ORF | 516 bp |
Locus ID | 23786 |
Cytogenetics | 22q11.21 |
Protein Families | Druggable Genome, Transmembrane |
MW | 19 kDa |
Gene Summary | This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (10) lacks two alternate exons in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (h) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.