GNAL (NM_001261444) Human Untagged Clone
CAT#: SC330712
GNAL (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 5
"NM_001261444" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNAL |
Synonyms | DYT25 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330712 representing NM_001261444.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTTTGATGTTGGTGGCCAGAGGGATGAGAGGAGAAAATGGATCCAGTGCTTTAACGATGTCACAGCT ATCATTTACGTCGCAGCCTGCAGTAGCTACAACATGGTGATTCGAGAAGATAACAACACCAACAGGCTG AGAGAGTCCCTGGATCTTTTTGAAAGCATCTGGAACAACAGGTGGTTACGGACCATTTCTATCATCTTG TTCTTGAACAAACAAGATATGCTGGCAGAAAAAGTCTTGGCAGGGAAATCAAAAATTGAAGACTATTTC CCAGAATATGCAAATTATACTGTTCCTGAAGACGCAACACCAGATGCAGGAGAAGATCCCAAAGTTACA AGAGCCAAGTTCTTTATCCGGGACCTGTTTTTGAGGATCAGCACGGCCACCGGTGACGGCAAACATTAC TGCTACCCGCACTTCACCTGCGCCGTGGACACAGAGAACATCCGCAGGGTGTTCAACGACTGCCGCGAC ATCATCCAGCGGATGCACCTCAAGCAGTATGAGCTCTTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001261444 |
Insert Size | 525 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001261444.1 |
RefSeq Size | 5568 bp |
RefSeq ORF | 525 bp |
Locus ID | 2774 |
UniProt ID | P38405 |
Cytogenetics | 18p11.21 |
Protein Families | Druggable Genome |
Protein Pathways | Calcium signaling pathway, Olfactory transduction |
MW | 20.5 kDa |
Gene Summary | This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (5) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231965 | GNAL (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 5 |
USD 330.00 |
|
RG231965 | GNAL (tGFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 5 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review