PSMD9 (NM_001261400) Human Untagged Clone

CAT#: SC330702

PSMD9 (untagged) - Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 (PSMD9), transcript variant 2


  "NM_001261400" in other vectors (2)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PSMD9 mouse monoclonal antibody,clone OTI5H2
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PSMD9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSMD9
Synonyms p27; Rpn4
Vector pCMV6-Entry
Sequence Data
>SC330702 representing NM_001261400.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAGGCCGGCGTCGTGACTGTCAGCGACGTC
CAGGAGCTGATGCGGCGCAAGGAGGAGATAGAAGCGCAGATCAAGGCCAACTATGACGTGCTGGAAAGC
GGTCTGCAAGTGGATGATGAGATTGTGGAGTTCGGCTCTGTGAACACCCAGAACTTCCAGTCACTGCAT
AACATTGGCAGTGTGGTGCAGCACAGTGAGGGGAAGCCCCTGAATGTGACAGTGATCCGCAGGGGGGAA
AAACACCAGCTTAGACTTGTTCCAACACGCTGGGCAGGAAAAGGACTGCTGGGCTGCAACATTATTCCT
CTGCAAAGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001261400
Insert Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261400.1
RefSeq Size 2053 bp
RefSeq ORF 357 bp
Locus ID 5715
UniProt ID O00233
Cytogenetics 12q24.31
MW 13.1 kDa
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (2) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.