TBC1D7 (NM_001258457) Human Untagged Clone
CAT#: SC330685
TBC1D7 (untagged) - Homo sapiens TBC1 domain family, member 7 (TBC1D7), transcript variant 5
"NM_001258457" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "TBC1D7"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TBC1D7 |
Synonyms | MGCPH; PIG51; TBC7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330685 representing NM_001258457.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGACTGAGGACTCTCAGAGAAACTTTCGTTCAGTATATTATGAGAAAGTGGGGTTTCGTGGAGTTGAA GAAAAGAAATCATTAGAAATTCTCCTAAAAGATGACCGTCTGGATACTGAGAAACTTTGTACTTTTAGT CAGAGGTTCCCTCTCCCGTCCATGTACCGTGCATTGGTATGGAAGGTGCTTCTAGGAATCTTGCCTCCA CACCACGAGTCCCATGCCAAGGTGATGATGTATCGTAAGGAGCAGTACTTGGATGTCCTTCATGCCCTG AAAGTCGTTCGCTTTGTTAGTGATGCCACACCTCAGGCTGAAGTCTATCTCCGCATGTATCAGCTGGAG TCTGGGAAGTTACCTCGAAGTCCCTCTTTTCCACTGCCAAAAGCGTTTGAACAATACTTGAATCTGGAA GATGGCAGACTGCTGACTCATCTGAGGATGTGTTCCGCGGCGCCCAAACTTCCTTATGATCTCTGGTTC AAGAGGTGCTTTGCGGGATGTTTGCCTGAATCCAGTTTACAGAGGGTTTGGGATAAAGTTGTGAGTGGA TCCTGTAAGATCCTAGTTTTTGTAGCTGTCGAAATTTTATTAACCTTTAAAATAAAAGTTATGGCACTG AACAGTGCAGAGAAGATAACAAAGTTTCTGGAAAATATTCCCCAGGACAGCTCAGACGCGATCGTGAGC AAGGCCATTGACTTGTGGCACAAACACTGTGGGACCCCGGTCCATTCAAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258457 |
Insert Size | 744 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001258457.2 |
RefSeq Size | 1042 bp |
RefSeq ORF | 744 bp |
Locus ID | 51256 |
UniProt ID | Q9P0N9 |
Cytogenetics | 6p24.1 |
MW | 28.5 kDa |
Gene Summary | This gene encodes a member of the TBC-domain containing protein family. The encoded protein functions as a subunit of the tuberous sclerosis TSC1-TSC2 complex which plays a role in the regulation of cellular growth and differentiation. Mutations in this gene have been associated with autosomal recessive megalencephaly. Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between this locus and downstream LOC100130357. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR and lacks an in-frame exon in the central coding region compared to variant 1, which results in a shorter isoform (c) than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.