HMBS (NM_001258208) Human Untagged Clone

CAT#: SC330636

HMBS (untagged) - Homo sapiens hydroxymethylbilane synthase (HMBS), transcript variant 3


  "NM_001258208" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
HMBS mouse monoclonal antibody, clone OTI3F4 (formerly 3F4)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HMBS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HMBS
Synonyms PBG-D; PBGD; PORC; UPS
Vector pCMV6-Entry
Sequence Data
>SC330636 representing NM_001258208.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTGGTAACGGCAATGCGGCTGCAACGGCGGAAGAAAACAGCCCAAAGATGAGAGTGATTCGCGTG
GGTACCCGCAAGAGCCAGCTTGCTCGCATACAGACGGACAGTGTGGTGGCAACATTGAAAGCCTCGTAC
CCTGGCCTGCAGTTTGAAATCATTGCTATGTCCACCACAGGGGACAAGATTCTTGATACTGCACTCTCT
AAGATTGGAGAGAAAAGCCTGTTTACCAAGGAGCTTGAACATGCCCTGGAGAAGAATGAAGTGGACCTG
GTTGTTCACTCCTTGAAGGACCTGCCCACTGTGCTTCCTCCTGGCTTCACCATCGGAGCCATCTGCAAG
CGGGAAAACCCTCATGATGCTGTTGTCTTTCACCCAAAATTTGTTGGGAAGACCCTAGAAACCCTGCCA
GAGAAGAGTGTGGTGGGAACCAGCTCCCTGCGAAGAGCAGCCCAGCTGCAGAGAAAGTTCCCGCATCTG
GAGTTCAGGAGTATTCGGGGAAACCTCAACACCCGGCTTCGGAAGCTGGACGAGCAGCAGGAGTTCAGT
GCCATCATCCTGGCAACAGCTGGCCTGCAGCGCATGGGCTGGCACAACCGGGTGGGGCAGATCCTGCAC
CCTGAGGAATGCATGTATGCTGTGGGCCAGGAAGGAGGCTGCAGTGTGCCAGTAGCCGTGCATACAGCT
ATGAAGGATGGGCAACTGTACCTGACTGGAGGAGTCTGGAGTCTAGACGGCTCAGATAGCATACAAGAG
ACCATGCAGGCTACCATCCATGTCCCTGCCCAGCATGAAGATGGCCCTGAGGATGACCCACAGTTGGTA
GGCATCACTGCTCGTAACATTCCACGAGGGCCCCAGTTGGCTGCCCAGAACTTGGGCATCAGCCTGGCC
AACTTGTTGCTGAGCAAAGGAGCCAAAAACATCCTGGATGTTGCACGGCAGCTTAACGATGCCCATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001258208
Insert Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258208.1
RefSeq Size 1406 bp
RefSeq ORF 966 bp
Locus ID 3145
UniProt ID P08397
Cytogenetics 11q23.3
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Porphyrin and chlorophyll metabolism
MW 34.9 kDa
Gene Summary This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.