BCS1L (NM_001257343) Human Untagged Clone

CAT#: SC330605

BCS1L (untagged) - Homo sapiens BC1 (ubiquinol-cytochrome c reductase) synthesis-like (BCS1L), transcript variant 4


  "NM_001257343" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
BCS1L Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "BCS1L"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BCS1L
Synonyms BCS; BCS1; BJS; FLNMS; GRACILE; h-BCS; h-BCS1; Hs.6719; MC3DN1; PTD
Vector pCMV6-Entry
Sequence Data
>SC330605 representing NM_001257343.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCACTTTCAGACTTTATTCTGGCTCTGAAGGACAATCCCTACTTTGGGGCTGGATTTGGGCTGGTG
GGTGTGGGCACAGCCCTGGCCCTGGCCCGGAAGGGTGTCCAACTGGGCCTGGTGGCATTCCGGCGCCAT
TACATGATCACACTGGAAGTCCCTGCTCGAGACAGGAGCTATGCCTGGTTGCTTAGCTGGCTCACCCGC
CACAGTACCCGTACTCAGCACCTCAGTGTCGAGACTTCGTACCTTCAGCATGAGAGTGGCCGCATTTCC
ACTAAGTTTGAATTTGTCCCCAGCCCTGGAAACCATTTTATCTGGTATCGGGGGAAATGGATTCGGGTA
GAACGAAGTCGAGAGATGCAGATGATAGACTTGCAGACGGGGACTCCTTGGGAATCTGTCACCTTCACG
GCCCTGGGCACTGACCGAAAGGTTTTCTTCAACATCCTGGAGGAAGCTCGAGAGCTAGCCTTGCAGCAG
GAGGAAGGGAAGACCGTGATGTACACAGCTGTGGGCTCTGAATGGCGTCCCTTTGGCTATCCACGCCGC
CGGCGACCACTGAATTCTGTGGTTCTACAACAGGGTCTGGCTGACCGAATTGTCAGAGACGTCCAGGAA
TTCATCGATAACCCCAAGTGGTACACTGACAGAGGCATTCCTTACAGACGTGGCTACCTGCTTTATGGG
CCCCCTGGTTGCGGAAAGAGCAGTTTTATCACAGCCCTGGCTGGGGAACTGGAGCACAGCATCTGCCTG
CTGAGCCTCACGGACTCCAGCCTCTCTGATGACCGACTCAACCACCTGCTGAGCGTGGCCCCGCAGCAG
AGCCTGGTACTCCTGGAGGATGTGGATGCTGCTTTTCTCAGTCGAGACTTGGCTGTGGAGAACCCAGTA
AAGTACCAAGGCCTAGGTCGCCTCACCTTCAGTGGACTGCTCAATGCCTTGGATGGTGTGGCTTCCACC
GAGGCCCGCATCGTGTTCATGACCACCAACCACGTTGACAGGCTGGACCCTGCCCTGATACGCCCGGGG
CGAGTGGACCTGAAGGAGTACGTGGGCTACTGCTCACACTGGCAGCTGACCCAGATGTTCCAGAGGTTC
TATCCAGGGCAGGCACCTTCCTTAGCTGAGAACTTTGCAGAACATGTCCTTCGAGCTACAAACCAGATC
AGTCCTGCCCAGGTGCAGGGCTACTTCATGCTGTATAAAAATGACCCTGTAGGGGCAATTCACAATGCT
GAGTCTCTGAGGAGGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001257343
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257343.1
RefSeq Size 1636 bp
RefSeq ORF 1260 bp
Locus ID 617
UniProt ID Q9Y276
Cytogenetics 2q35
Protein Families Druggable Genome
MW 47.5 kDa
Gene Summary This gene encodes a homolog of the S. cerevisiae bcs1 protein which is involved in the assembly of complex III of the mitochondrial respiratory chain. The encoded protein does not contain a mitochondrial targeting sequence but experimental studies confirm that it is imported into mitochondria. Mutations in this gene are associated with mitochondrial complex III deficiency and the GRACILE syndrome. Several alternatively spliced transcripts encoding two different isoforms have been described. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 5, and 7 all encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.