DIS3L2 (NM_001257282) Human Untagged Clone
CAT#: SC330593
DIS3L2 (untagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3
"NM_001257282" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DIS3L2 |
Synonyms | FAM6A; hDIS3L2; PRLMNS |
Vector | pCMV6-Entry |
Sequence Data |
>SC330593 representing NM_001257282.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGCCATCCTGACTACAGAATGAACCTCCGGCCCCTGGGGACCCCCAGAGGTGTGTCTGCTGTGGCT GGTCCACATGACATTGGTGCTTCGCCAGGTGACAAAAAGTCAAAGAACAGGTCCACACGAGGGAAGAAA AAGAGCATATTTGAAACTTACATGTCCAAGGAGGATGTTTCAGAAGGCTTGAAGAGAGGAACACTCATC CAGGGTGTATTGAGAATTAATCCAAAGAAGTTTCATGAAGCCTTCATTCCTTCCCCGGATGGTGATCGA GACATTTTTATTGATGGGGTTGTTGCTCGTAATAGAGCCTTAAATGGGGATCTGGTGGTCGTGAAACTG CTTCCCGAGGAGCATTGGAAGGTAGTTAAACCAGAGAGCAATGACAAAGAAACAGAAGCTGCGTATGAA TCAGATATCCCCGAGGAGCTCTGTGGACACCATCTCCCGCAACAGTCCCTGAAAAGCTATAATGACAGT CCTGATGTCATTGTAGAGGCTCAGTTTGATGGCAGCGACTCAGAAGATGGACATGGCATCACACAAAAT GTGCTGGTTGATGGTGTTAAGAAACTCTCAGTTTGTGTTTCTGAGAAAGGAAGAGAGGATGGTGATGCA CCGGTTACAAAAGATGAGACCACCTGCATTTCACAAGACACAAGAGCTTTATCGGAGAAATCCCTGCAA AGATCAGCAAAGGTCATTGCCTACAGATTTTCTCCACGTGTCCAAATGGCTTTCACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257282 |
Insert Size | 750 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001257282.1 |
RefSeq Size | 1154 bp |
RefSeq ORF | 750 bp |
Locus ID | 129563 |
UniProt ID | Q8IYB7 |
Cytogenetics | 2q37.1 |
MW | 27.5 kDa |
Gene Summary | The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232280 | DIS3L2 (Myc-DDK tagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3 |
USD 330.00 |
|
RG232280 | DIS3L2 (tGFP-tagged) - Homo sapiens DIS3 mitotic control homolog (S. cerevisiae)-like 2 (DIS3L2), transcript variant 3 |
USD 530.00 |
{0} Product Review(s)
Be the first one to submit a review