Caspase 1 (CASP1) (NM_001257119) Human Untagged Clone
CAT#: SC330568
CASP1 (untagged) - Homo sapiens caspase 1, apoptosis-related cysteine peptidase (CASP1), transcript variant 7
"NM_001257119" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (4)
Other products for "Caspase 1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | Caspase 1 |
Synonyms | ICE; IL1BC; P45 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330568 representing NM_001257119.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCATGGGTGAAGGTACAATAAAT GGCTTACTGGATGAATTATTACAGACAAGGGTGCTGAACAAGGAAGAGATGGAGAAAGTAAAACGTGAA AATGCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCCGTTATTCCGAAAGGGGCACAGGCATGC CAAATTTGCATCACATACATTTGTGAAGAAGACAGTTACCTGGCAGGGACGCTGGGACTCTCAGCAGCT CCTCAGGCAGTGCAGGACAACCCAGCTATGCCCACATCCTCAGGCTCAGAAGGGAATGTCAAGCTTTGC TCCCTAGAAGAAGCTCAAAGGATATGGAAACAAAAGTCGGCAGAGATTTATCCAATAATGGACAAGTCA AGCCGCACACGTCTTGCTCTCATTATCTGCAATGAAGAATTTGACAGTATTCCTAGAAGAACTGGAGCT GAGGTTGACATCACAGGCATGACAATGCTGCTACAAAATCTGGGGTACAGCGTAGATGTGAAAAAAAAT CTCACTGCTTCGGACATGACTACAGAGCTGGAGGCATTTGCACACCGCCCAGAGCACAAGACCTCTGAC AGCACGTTCCTGGTGTTCATGTCTCATGGTATTCGGGAAGGCATTTGTGGGAAGAAACACTCTGAGCAA GTCCCAGATATACTACAACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTGAAG GACAAACCGAAGGTGATCATCATCCAGGCCTGCCGTGGTGACAGCCCTGGTGTGGTGTGGTTTAAAGAT TCAGTAGGAGTTTCTGGAAACCTATCTTTACCAACTACAGAAGAGTTTGAGGATGATGCTATTAAGAAA GCCCACATAGAGAAGGATTTTATCGCTTTCTGCTCTTCCACACCAGATAATGTTTCTTGGAGACATCCC ACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATATGCAAGAATATGCCTGTTCCTGTGATGTG GAGGAAATTTTCCGCAAGGTTCGATTTTCATTTGAGCAGCCAGATGGTAGAGCGCAGATGCCCACCACT GAAAGAGTGACTTTGACAAGATGTTTCTACCTCTTCCCAGGACATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257119 |
Insert Size | 1152 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001257119.1 |
RefSeq Size | 1956 bp |
RefSeq ORF | 1152 bp |
Locus ID | 834 |
UniProt ID | P29466 |
Cytogenetics | 11q22.3 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Amyotrophic lateral sclerosis (ALS), Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway |
MW | 42.9 kDa |
Gene Summary | This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (7) lacks an alternate in-frame exon and differs in the 3' UTR compared to variant alpha. Variant beta and variant 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.