CCDC51 (NM_001256966) Human Untagged Clone

CAT#: SC330561

CCDC51 (untagged) - Homo sapiens coiled-coil domain containing 51 (CCDC51), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCDC51
• Synonyms: MITOK
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330561 representing NM_001256966.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGTGGCTCGAGGGCTTGTCCGAGAGGCTCGGGAGGACTTGGAAGTTCACCAGGCCAAGCTGAAGGAG
  GTGAGGGACCGCTTGGACCGTGTCTCCAGGGAGGACAGTCAGTACTTGGAACTGGCTACTCTCGAGCAC
  AGGATGCTGCAGGAGGAGAAGAGGCTTCGCACAGCCTATCTGCGTGCAGAAGACTCTGAGCGAGAGAAG
  TTCTCCCTCTTCTCTGCAGCTGTGCGGGAAAGTCATGAGAAGGAGCGCACAAGGGCTGAGAGGACCAAG
  AACTGGTCCCTCATTGGCTCAGTCCTGGGGGCCCTGATTGGTGTGGCTGGCTCCACCTATGTGAACCGT
  GTGCGACTACAGGAGCTGAAGGCTTTACTCCTGGAGGCGCAGAAGGGGCCTGTGAGTCTCCAAGAGGCC
  ATTCGAGAACAGGCGTCTAGCTACTCCCGCCAGCAGAGGGACCTCCACAATCTCATGGTGGACTTGAGG
  GGCCTGGTACATGCTGCTGGGCCAGGGCAGGACTCTGGGTCACAGGCAGGTAGTCCCCCGACCAGAGAC
  AGAGATGTAGATGTCCTTTCAGCTGCCTTGAAAGAGCAGCTTAGTCATTCCAGGCAAGTCCATTCATGT
  CTAGAAGGCTTACGAGAGCAGCTTGATGGCCTAGAAAAGACTTGTAGCCAAATGGCTGGGGTGGTTCAG
  CTTGTAAAGTCTGCAGCACACCCAGGCCTGGTGGAACCAGCAGACGGGGCTATGCCCAGCTTCTTGCTG
  GAGCAGGGGAGCATGATCTTGGCACTGTCAGACACGGAGCAGAGACTAGAAGCCCAAGTCAACAGGAAC
  ACCATCTATAGCACCCTGGTCACCTGTGTGACATTTGTGGCCACACTGCCTGTGCTCTACATGCTATTC
  AAAGCCAGCTAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256966
• Insert Size: 909 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256966.1
• RefSeq Size: 1506 bp
• RefSeq ORF: 909 bp
• Locus ID: 79714
• UniProt ID: Q96ER9
• Cytogenetics: 3p21.31
• Protein Families: Transmembrane
• MW: 33.7 kDa
• Gene Summary: Mitochondrial potassium channel located in the mitochondrial inner membrane (PubMed:31435016). Together with ABCB8/MITOSUR, forms a protein complex localized in the mitochondria that mediates ATP-dependent potassium currents across the inner membrane (that is, mitoK(ATP) channel) (PubMed:31435016). May contribute to the homeostatic control of cellular metabolism under stress conditions by regulating the mitochondrial matrix volume (PubMed:31435016).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) uses an alternate splice site in the 5' region and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 3, 4, 5, 6 and 7 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.