STOML1 (NM_001256677) Human Untagged Clone

CAT#: SC330484

STOML1 (untagged) - Homo sapiens stomatin (EPB72)-like 1 (STOML1), transcript variant 7


  "NM_001256677" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "STOML1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STOML1
Synonyms hUNC-24; SLP-1; STORP
Vector pCMV6-Entry
Sequence Data
>SC330484 representing NM_001256677.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCAGATGTACCCCAGAGCTGGCCCTCCTGCCTCTGTCATGGCCTCATCAGTTTCCTGGGGTTCTTG
CTGCTGTTGGTCACCTTCCCCATTTCTGGCTGGTTTGCCCTGAAGATTGTGCCCACCTACGAGCGGATG
ATTGTGTTCCGCCTGGGCCGGATCCGCACCCCCCAGGGACCTGGCATGGTTCTGCTCTTGCCCTTCATT
GACTCCTTTCAGAGGGTGGATCTGAGGACACGAGCCTTCAACGTCCCTCCCTGCAAGCTGGCCTCTAAG
GACGGGGCTGTGCTGTCCGTGGGAGCCGATGTCCAGTTTCGCATCTGGGACCCGGTGCTGTCGGTGATG
ACTGTGAAAGACCTGAACACAGCCACACGCATGACAGCCCAGAACGCCATGACCAAGGCCCTGCTCAAG
AGGCCGCTGCGGGAGATCCAGATGGAGAAGCTCAAGATCAGCGACCAGCTTCTGCTGGAGATCAACGAT
GTGACCAGGGCCTGGGGGCTGGAGGTAGACCGCGTGGAGCTGGCAGTGGAGGCCGTGCTCCAGCCGCCC
CAGGACAGCCCAGCTGGGCCCAACCTGGACAGCACCCTCCAGCAGCTGGCCCTGCACTTCCTGGGAGGA
AGCATGAACTCAATGGCAGGAGGTGCCCCGTCCCCGGGGCCAGACACCGTGGAGATGGTGAGTGAAGTT
GAGCCACCTGCCCCTCAAGTTGGTGCCAGGTCCAGTCCGAAGCAGCCTCTGGCGGAGGGGCTACTGACT
GCTCTACAGCCCTTCCTGTCTGAGGCCCTGGTCAGCCAAGTCGGGGCCTGCTACCAGTTCAATGTCGTC
CTGCCCAGCGGCACCCAAAGCGCCTACTTCCTGGACCTCACTACAGGACGAGGAAGAGTGGGACACGGG
GTGCCTGATGGCATCCCTGATGTGGTGGTGGAGATGGCCGAGGCAGACCTGCGGGCCCTGCTATGCAGA
GAGCTGCGGCCCCTGGGGGCCTACATGAGTGGACGGCTGAAGGTGAAGGGCGACCTGGCTATGGCCATG
AAGCTGGAGGCTGTCCTCAGGGCCTTGAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256677
Insert Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256677.1
RefSeq Size 2169 bp
RefSeq ORF 1068 bp
Locus ID 9399
UniProt ID Q9UBI4
Cytogenetics 15q24.1
Protein Families Transmembrane
MW 38.5 kDa
Gene Summary May play a role in cholesterol transfer to late endosomes (PubMed:19696025). May play a role in modulating membrane acid-sensing ion channels. Can specifically inhibit proton-gated current of ASIC1 isoform 1. Can increase inactivation speed of ASIC3. May be involved in regulation of proton sensing in dorsal root ganglions (By similarity). May play a role in protecting FBXW7 isoform 3 from degradation (PubMed:23082202).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) contains an alternate exon in the 5' region, initiates translation at an alternate start codon and uses an alternate in-frame splice site in the coding region, compared to variant 1. the encoded isoform (7) is shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.