Apolipoprotein M (APOM) (NM_001256169) Human Untagged Clone

CAT#: SC330378

APOM (untagged) - Homo sapiens apolipoprotein M (APOM), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Apolipoprotein M
• Synonyms: apo-M; G3a; HSPC336; NG20
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330378 representing NM_001256169.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCTGCTGGCTCTGCCCCGATGCAGCTCCACCTTCGTGCTACCATCCGCATGAAAGATGGGCTCTGT
  GTGCCCCGGAAATGGATCTACCACCTGACTGAAGGGAGCACAGATCTCAGAACTGAAGGCCGCCCTGAC
  ATGAAGACTGAGCTCTTTTCCAGCTCATGCCCAGGTGGAATCATGCTGAATGAGACAGGCCAGGGTTAC
  CAGCGCTTTCTCCTCTACAATCGCTCACCACATCCTCCCGAAAAGTGTGTGGAGGAATTCAAGTCCCTG
  ACTTCCTGCCTGGACTCCAAAGCCTTCTTATTGACTCCTAGGAATCAAGAGGCCTGTGAGCTGTCCAAT
  AACTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256169
• Insert Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256169.1
• RefSeq Size: 722 bp
• RefSeq ORF: 351 bp
• Locus ID: 55937
• UniProt ID: O95445
• Cytogenetics: 6p21.33
• Protein Families: Secreted Protein
• MW: 13.1 kDa
• Gene Summary: The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.