IFT43 (NM_001255995) Human Untagged Clone

CAT#: SC330343

IFT43 (untagged) - Homo sapiens intraflagellar transport 43 homolog (Chlamydomonas) (IFT43), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IFT43
• Synonyms: C14orf179; CED3; RP81; SRTD18
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330343 representing NM_001255995.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTCCAGGGCCAAGATGGGT
  CGCCGAGCTCAACAGGAGTCAGCGCAGGCCGAGAATCACCTCAATGGCAAGAATTCCTCTTTGACTCTG
  ACTGGAGAGACTTCCTCTGCTAAATTACCTCGCTGCCGACAGGGAGGCTGGGCAGGTGATTCCGTGAAG
  GCTTCGAAGTTTAGGAGGAAGGCTTCTGAAGAAATAGAAGAGTACGTTTCCAGTATTCTTATTCTTATG
  GTATCCTATGTTGATCTTGGTCAACAGTGCAGTCTTGGTGGTCATGATCTGTTCCACCTATGTTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001255995
• Insert Size: 342 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001255995.1
• RefSeq Size: 911 bp
• RefSeq ORF: 342 bp
• Locus ID: 112752
• UniProt ID: Q96FT9
• Cytogenetics: 14q24.3
• MW: 12.5 kDa
• Gene Summary: This gene encodes a subunit of the intraflagellar transport complex A (IFT-A). IFT-A is a multiprotein complex that plays an important role in cilia assembly and maintenance by mediating retrograde ciliary transport. Mutations in this gene are a cause of cranioectodermal dysplasia-3 (CED3), also known as Sensenbrenner syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.