RAP1B (NM_001251918) Human Untagged Clone
CAT#: SC330247
RAP1B (untagged) - Homo sapiens RAP1B, member of RAS oncogene family (RAP1B), transcript variant 4
"NM_001251918" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "RAP1B"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAP1B |
Synonyms | K-REV; RAL1B |
Vector | pCMV6-Entry |
Sequence Data |
>SC330247 representing NM_001251918.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGGAGCAATTTACA GCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTAGTTTATTCCATCACAGCACAGTCC ACATTTAACGATTTACAAGACCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATG ATTCTTGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTA GCAAGACAATGGAACAACTGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATC TTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCA TGTCAGCTGCTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001251918 |
Insert Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001251918.1 |
RefSeq Size | 2037 bp |
RefSeq ORF | 429 bp |
Locus ID | 5908 |
UniProt ID | P61224 |
Cytogenetics | 12q15 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Long-term potentiation, MAPK signaling pathway, Neurotrophin signaling pathway, Renal cell carcinoma |
MW | 16 kDa |
Gene Summary | This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (4) differs in the 5' UTR and lacks two in-frame exons in the coding region, compared to variant 1. The resulting isoform (2) is shorter, compared to isoform 1. Variants 3 and 4 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.