PRPSAP2 (NM_001243936) Human Untagged Clone

CAT#: SC330194

PRPSAP2 (untagged) - Homo sapiens phosphoribosyl pyrophosphate synthetase-associated protein 2 (PRPSAP2), transcript variant 2


  "NM_001243936" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PRPSAP2 mouse monoclonal antibody, clone OTI1E3 (formerly 1E3)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PRPSAP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRPSAP2
Synonyms PAP41
Vector pCMV6-Entry
Sequence Data
>SC330194 representing NM_001243936.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTTTGTGTGACGCCACCTGAATTAGAAACCAAGATGAACATAACCAAAGGTGGTCTGGTGTTGTTT
TCAGCAAACTCGAATTCATCATGTATGGAGCTATCAAAGAAAATTGCAGAGGACGTGAACACCACCATC
ATGGAGCTCCTGATCATGGTGTATGCATGTAAGACCTCTTGTGCCAAGAGCATCATTGGCGTGATACCC
TACTTTCCTTACAGCAAGCAGTGCAAGATGAGAAAAAGAGGCTCCATTGTCTCTAAATTGCTGGCTTCC
ATGATGTGCAAAGCTGGTCTAACTCATCTTATTACTATGGATTTACACCAGAAGGAAATTCAGGGCTTC
TTCAATATTCCTGTTGACAATTTAAGAGCATCTCCCTTCTTATTACAGTATATTCAAGAAGAGATCCCA
GATTACAGGAATGCAGTAATCGTGGCCAAGTCTCCAGCCTCGGCGAAGAGGGCACAGTCTTTTGCTGAG
CGCCTGCGCCTGGGAATTGCAGTGATTCATGGAGAGGCGCAGGATGCCGAGTCGGACTTGGTGGATGGA
CGGCATTCCCCACCCATGGTCAGAAGTGTGGCTGCCATCCACCCCAGCCTGGAGATCCCCATGCTGATT
CCTAAAGAAAAGCCCCCAATCACGGTTGTGGGTGATGTTGGAGGAAGGATTGCCATCATCGTGGATGAC
ATCATTGATGATGTTGACAGCTTTCTTGCTGCAGCAGAGACCCTGAAGGAAAGAGGTGCATATAAGATC
TTTGTGATGGCAACTCATGGCTTGTTGTCTTCTGACGCCCCCCGGCGGATTGAAGAGTCTGCCATTGAT
GAGGTGGTGGTCACCAATACAATTCCACATGAAGTCCAGAAGCTCCAGTGCCCCAAGATTAAAACTGTG
GATATCAGCATGATCCTTTCAGAGGCGATCCGTCGGATCCACAATGGGGAGTCCATGTCCTACCTTTTC
AGAAACATAGGCTTAGATGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243936
Insert Size 990 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243936.1
RefSeq Size 1838 bp
RefSeq ORF 990 bp
Locus ID 5636
UniProt ID O60256
Cytogenetics 17p11.2
Protein Families Druggable Genome
MW 36.3 kDa
Gene Summary This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks two in-frame exons in the coding region and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.