LIM domain only 3 (LMO3) (NM_001243610) Human Untagged Clone

CAT#: SC330151

LMO3 (untagged) - Homo sapiens LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LIM domain only 3
• Synonyms: RBTN3; RBTNL2; Rhom-3; RHOM3
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330151 representing NM_001243610.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGCTCTCAGTCCAGCCAGACACCAAGCCGAAAGGTTGTGCTGGCTGCAACCGAAAGATCAAGGACCGG
  TATCTTCTAAAGGCACTGGACAAATACTGGCATGAAGACTGCCTGAAGTGTGCCTGCTGTGACTGTCGC
  TTGGGAGAGGTGGGCTCCACCCTGTACACTAAAGCTAATCTTATCCTTTGTCGCAGAGACTATCTGAGG
  CTCTTTGGTGTAACGGGAAACTGCGCTGCCTGTAGTAAGCTCATCCCTGCCTTTGAGATGGTGATGCGT
  GCCAAGGACAATGTTTACCACCTGGACTGCTTTGCATGTCAGCTTTGTAATCAGAGATTTTGTGTTGGA
  GACAAATTTTTCCTAAAGAATAACATGATCCTTTGCCAGACGGACTACGAGGAAGGTTTAATGAAAGAA
  GGTTATGCACCCCAGGTTCGCTGA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243610
• Insert Size: 438 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243610.1
• RefSeq Size: 3431 bp
• RefSeq ORF: 438 bp
• Locus ID: 55885
• UniProt ID: Q8TAP4
• Cytogenetics: 12p12.3
• Protein Families: Transcription Factors
• MW: 16.6 kDa
• Gene Summary: The protein encoded by this gene belongs to the rhombotin family of cysteine-rich LIM domain oncogenes. This gene is predominantly expressed in the brain. Related family members, LMO1 and LMO2 on chromosome 11, have been reported to be involved in chromosomal translocations in T-cell leukemia. Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (4) differs at the 5' end compared to variant 1. Variants 1-4 encode the same isoform (1).