IL18 (NM_001243211) Human Untagged Clone
CAT#: SC330096
IL18 (untagged) - Homo sapiens interleukin 18 (interferon-gamma-inducing factor) (IL18), transcript variant 2
"NM_001243211" in other vectors (2)
Product Images
Frequently bought together (4)
Other products for "IL18"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL18 |
Synonyms | IGIF; IL-1g; IL-18; IL1F4 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330096 representing NM_001243211.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGCTGAACCAGTAGAAGACAATTGCATCAACTTTGTGGCAATGAAATTTATTGACAATACGCTT TACTTTATAGAAAACCTGGAATCAGATTACTTTGGCAAGCTTGAATCTAAATTATCAGTCATAAGAAAT TTGAATGACCAAGTTCTCTTCATTGACCAAGGAAATCGGCCTCTATTTGAAGATATGACTGATTCTGAC TGTAGAGATAATGCACCCCGGACCATATTTATTATAAGTATGTATAAAGATAGCCAGCCTAGAGGTATG GCTGTAACTATCTCTGTGAAGTGTGAGAAAATTTCAACTCTCTCCTGTGAGAACAAAATTATTTCCTTT AAGGAAATGAATCCTCCTGATAACATCAAGGATACAAAAAGTGACATCATATTCTTTCAGAGAAGTGTC CCAGGACATGATAATAAGATGCAATTTGAATCTTCATCATACGAAGGATACTTTCTAGCTTGTGAAAAA GAGAGAGACCTTTTTAAACTCATTTTGAAAAAAGAGGATGAATTGGGGGATAGATCTATAATGTTCACT GTTCAAAACGAAGACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243211 |
Insert Size | 570 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243211.1 |
RefSeq Size | 1151 bp |
RefSeq ORF | 570 bp |
Locus ID | 3606 |
UniProt ID | Q14116 |
Cytogenetics | 11q23.1 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway |
MW | 21.9 kDa |
Gene Summary | The protein encoded by this gene is a proinflammatory cytokine of the IL-1 family that is constitutively found as a precursor within the cytoplasm of a variety of cells including macrophages and keratinocytes. The inactive IL-18 precursor is processed to its active form by caspase-1, and is capable of stimulating interferon gamma production, and of regulating both T helper (Th) 1 and Th2 responses. This cytokine has been implicated in the injury of different organs, and in potentially fatal conditions characterized by a cytokine storm. In humans, IL-18 gene is located on chromosome 11. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2020] Transcript Variant: This variant (2, also known as Delta3pro-IL-18) lacks an in-frame coding exon compared to variant 1. The encoded isoform (2) is shorter and may be resistant to proteolytic activation, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.