RFC5 (NM_001206801) Human Untagged Clone

CAT#: SC329839

RFC5 (untagged) - Homo sapiens replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RFC5
• Synonyms: RFC36
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329839 representing NM_001206801.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAGACCTCAGCACTCAAGCAGCAGGAGCAGCCCGCGGCGACCAAGATCAGGAACCTGCCCTGGGTT
  GAAAAATACCGGCCACAGACCCTGAATGATCTCATTTCTCATCAGGACATTCTGAGTACCATTCAGAAG
  TTTATCAATGAAGACCGACTGCCACACTTGCTTCTCTACGGTCCCCCAGGGACAGGCAAGACATCTACC
  ATCCTAGCCTGTGCGAAACAGCTATATAAAGACAAAGAATTTGGCTCCATGGTCTTGGAGCTGAATGCT
  TCAGATGACCGAGGAATAGACATCATTCGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTT
  AAGAAAGGCTTTAAGCTAGTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTG
  AGAAGAGTAATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATC
  ATCCCTGCCTTGCAGTCCCGCTGCACGAGGTTTCGGTTCGGTCCCCTGACTCCTGAACTCATGGTTCCC
  CGCCTGGAACATGTCGTGGAAGAAGAGAAAGTTGATATAAGTGAAGATGGAATGAAAGCACTAGTCACT
  CTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAGAGCACCAATATGGCCTTTGGGAAGGTG
  ACAGAGGAGACTGTCTACACCTGCACCGGGCACCCGCTCAAGTCAGACATTGCCAACATCCTGGACTGG
  ATGTTGAATCAAGATTTCACCACAGCCTACAGAAAGTTGAAAACTCTGAAGGGGTTGGCACTGCATGAT
  ATCCTGACAGAGATACACTTGTTTGTGCATAGAGTTGACTTTCCATCTTCAGTTCGAATACATTTATTG
  ACCAAAATGGCAGACATTGAGTACAGGCTTTCTGTTGGCACCAACGAGAAGATCCAGCTGAGCTCCCTC
  ATTGCTGCATTTCAAGTCACCAGAGACCTGATTGTTGCAGAGGCCTAG
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001206801
• Insert Size: 1014 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001206801.1
• RefSeq Size: 2113 bp
• RefSeq ORF: 1014 bp
• Locus ID: 5985
• Cytogenetics: 12q24.23
• Protein Families: Stem cell - Pluripotency
• Protein Pathways: DNA replication, Mismatch repair, Nucleotide excision repair
• MW: 38.2 kDa
• Gene Summary: This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
  Transcript Variant: This variant (5) uses an alternate in-frame splice site in the coding region, compared to variant 1. The resulting isoform (4) is shorter than isoform 1.