XIAP (NM_001204401) Human Untagged Clone

CAT#: SC329750

XIAP (untagged) - Homo sapiens X-linked inhibitor of apoptosis (XIAP), transcript variant 2


  "NM_001204401" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal XIAP Antibody
    • 100 ug

USD 570.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "XIAP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol XIAP
Synonyms API3; BIRC4; hIAP-3; hIAP3; IAP-3; ILP1; MIHA; XLP2
Vector pCMV6-Entry
Sequence Data
>SC329750 representing NM_001204401.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTTTTAACAGTTTTGAAGGATCTAAAACTTGTGTACCTGCAGACATCAATAAGGAAGAAGAATTT
GTAGAAGAGTTTAATAGATTAAAAACTTTTGCTAATTTTCCAAGTGGTAGTCCTGTTTCAGCATCAACA
CTGGCACGAGCAGGGTTTCTTTATACTGGTGAAGGAGATACCGTGCGGTGCTTTAGTTGTCATGCAGCT
GTAGATAGATGGCAATATGGAGACTCAGCAGTTGGAAGACACAGGAAAGTATCCCCAAATTGCAGATTT
ATCAACGGCTTTTATCTTGAAAATAGTGCCACGCAGTCTACAAATTCTGGTATCCAGAATGGTCAGTAC
AAAGTTGAAAACTATCTGGGAAGCAGAGATCATTTTGCCTTAGACAGGCCATCTGAGACACATGCAGAC
TATCTTTTGAGAACTGGGCAGGTTGTAGATATATCAGACACCATATACCCGAGGAACCCTGCCATGTAT
AGTGAAGAAGCTAGATTAAAGTCCTTTCAGAACTGGCCAGACTATGCTCACCTAACCCCAAGAGAGTTA
GCAAGTGCTGGACTCTACTACACAGGTATTGGTGACCAAGTGCAGTGCTTTTGTTGTGGTGGAAAACTG
AAAAATTGGGAACCTTGTGATCGTGCCTGGTCAGAACACAGGCGACACTTTCCTAATTGCTTCTTTGTT
TTGGGCCGGAATCTTAATATTCGAAGTGAATCTGATGCTGTGAGTTCTGATAGGAATTTCCCAAATTCA
ACAAATCTTCCAAGAAATCCATCCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATA
TACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAG
TGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAA
TGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACT
CATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGAT
ACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAA
ATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCAGATCTA
GTGAATGCTCAGAAAGACAGTATGCAAGATGAGTCAAGTCAGACTTCATTACAGAAAGAGATTAGTACT
GAAGAGCAGCTAAGGCGCCTGCAAGAGGAGAAGCTTTGCAAAATCTGTATGGATAGAAATATTGCTATC
GTTTTTGTTCCTTGTGGACATCTAGTCACTTGTAAACAATGTGCTGAAGCAGTTGACAAGTGTCCCATG
TGCTACACAGTCATTACTTTCAAGCAAAAAATTTTTATGTCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001204401
Insert Size 1494 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204401.1
RefSeq Size 8427 bp
RefSeq ORF 1494 bp
Locus ID 331
UniProt ID P98170
Cytogenetics Xq25
Protein Families Druggable Genome
Protein Pathways Apoptosis, Focal adhesion, NOD-like receptor signaling pathway, Pathways in cancer, Small cell lung cancer, Ubiquitin mediated proteolysis
MW 56.7 kDa
Gene Summary This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.