SEM1 (NM_001201450) Human Untagged Clone
CAT#: SC329621
C7orf76 (untagged) - Homo sapiens chromosome 7 open reading frame 76 (C7orf76), transcript variant 1
"NM_001201450" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (3)
Other products for "SEM1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SEM1 |
Synonyms | C7orf76; DSS1; ECD; SHFD1; Shfdg1; SHFM1; SHSF1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329621 representing NM_001201450.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTATTGCCAGGACTCCAACATTTGTGCTGTGTTTGCTGTACAAGGAGGAAAAGTGGGAAGAAAGCAT GGCATAAAAAGGGGGAGGAGACCCAGCATAAGAAGCCCAGCTCAGCGGGCCAGAGGACCCTGGATCCAT GAGAGTAAGCATCCGGCCTTTGCAAAGCAACAGATAAACTTGGAGATGCCCAACTCCAGAGCGACAACA GAGTTAGCCTGGGTCTGCAGCTCCACCTCAAGAAAAAAGAAGTGGGCAAGGTCCCTGACTCTTTCCACT GCTCCACTGAGCCCCCCACCATCCTTGGTGCACTGTGAAGATTGTTCTTGCCTGCCTGGCTGCCATTCG GGTGACCTCTACAATCTGGCCCCAGCAGAAAGAACTTGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201450 |
Insert Size | 387 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001201450.1 |
RefSeq Size | 2707 bp |
RefSeq ORF | 387 bp |
Locus ID | 7979 |
Cytogenetics | 7q21.3 |
Protein Pathways | Homologous recombination, Proteasome |
MW | 14.1 kDa |
Gene Summary | The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) represents the use of an alternate promoter, resulting in a different 5' UTR and use of an alternate start codon, compared to variant 1. It encodes isoform 4, which is longer and has a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.