DNAL1 (NM_001201366) Human Untagged Clone

CAT#: SC329617

DNAL1 (untagged) - Homo sapiens dynein, axonemal, light chain 1 (DNAL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNAL1
• Synonyms: C14orf168; CILD16; LC1
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329617 representing NM_001201366.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGATGCATCCTTGTCCATGCTTGCTAATTGCGAGAAGCTTTCACTGTCTACAAACTGCATTGAAAAA
  ATTGCCAACCTGAATGGCTTAAAAAACTTGAGGATATTATCTTTAGGAAGAAACAACATAAAGAACTTA
  AATGGACTGGAGGCAGTAGGGGACACATTAGAAGAACTGTGGATCTCCTACAATTTTATTGAGAAGTTG
  AAAGGGATCCACATAATGAAGAAATTGAAGATTCTCTACATGTCTAATAACCTGGTAAAAGACTGGGCT
  GAGTTTGTGAAGCTGGCAGAACTGCCATGCCTCGAAGACCTGGTGTTTGTAGGCAATCCCTTGGAAGAG
  AAACATTCTGCTGAGAATAACTGGATTGAAGAAGCAACCAAGAGAGTGCCCAAACTGAAAAAGCTGGAT
  GGTACTCCAGTAATTAAAGGGGATGAGGAAGAAGACAACTAA
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001201366
• Insert Size: 456 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001201366.1
• RefSeq Size: 8584 bp
• RefSeq ORF: 456 bp
• Locus ID: 83544
• UniProt ID: Q4LDG9
• Cytogenetics: 14q24.3
• Protein Pathways: Huntington's disease
• MW: 17.1 kDa
• Gene Summary: This gene encodes an axonemal dynein light chain which functions as a component of the outer dynein arms complex. This complex acts as the molecular motor that provides the force to move cilia in an ATP-dependent manner. The encoded protein is expressed in tissues with motile cilia or flagella and may be involved in the movement of sperm flagella. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.