HYAL3 (NM_001200029) Human Untagged Clone

CAT#: SC329609

HYAL3 (untagged) - Homo sapiens hyaluronoglucosaminidase 3 (HYAL3), transcript variant 5


  "NM_001200029" in other vectors (2)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Rabbit Polyclonal Anti-HYAL3 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "HYAL3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HYAL3
Synonyms HYAL-3; LUCA-3; LUCA3
Vector pCMV6-Entry
Sequence Data
>SC329609 representing NM_001200029.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCACGCAACTGGGCCCAGCCCTGGTGCTGGGGGTGGCCCTGTGCCTGGGTTGTGGCCAGCCCCTA
CCACAGGTCCCTGAACGCCCCTTCTCTGTGCTGTGGAATGTACCCTCAGCACACTGTGAGGCCCGCTTT
GGTGTGCACCTGCCACTCAATGCTCTGGGCATCATAGCCAACCGTGGCCAGCATTTTCACGGTCAGAAC
ATGACCATTTTCTACAAGAACCAACTCGGCCTCTATCCCTACTTTGGACCCAGGGGCACAGCTCACAAT
GGGGGCATCCCCCAGGCTTTGCCCCTTGACCGCCACCTGGCACTGGCTGCCTACCAGATCCACCACAGC
CTGAGACCTGGCTTTGCTGGCCCAGCAGTGCTGGATTGGGAGGAGTGGTGTCCACTCTGGGCTGGGAAC
TGGGGCCGCCGCCGAGCTTATCAGGCAGCCTCTTGGGCTTGGGCACAGCAGGTATTCCCTGACCTGGAC
CCTCAGGAGCAGCTCTACAAGGCCTATACTGGCTTTGAGCAGGCGGCCCGTGCACTGATGGAGGATACG
CTGCGGGTGGCCCAGGCACTACGGCCCCATGGACTCTGGGGCTTCTATCACTACCCAGCCTGTGGCAAT
GGCTGGCATAGTATGGCTTCCAACTATACCGGCCGCTGCCATGCAGCCACCCTTGCCCGCAACACTCAA
CTGCATTGGCTCTGGGCCGCCTCCAGTGCCCTCTTCCCCAGCATCTACCTCCCACCCAGGCTGCCACCT
GCCCACCACCAGGCCTTTGTCCGACATCGCCTGGAGGAGGCCTTCCGTGTGGCCCTTGTTGGGCACCGA
CATCCCCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCGGAGATCTGGGAGGTTCCTGTCCCAGGAT
GACCTTGTGCAGTCCATTGGTGTGAGTGCAGCACTAGGGGCAGCCGGCGTGGTGCTCTGGGGGGACCTG
AGCCTCTCCAGCTCTGAGGAGGAGTGCTGGCATCTCCATGACTACCTGGTGGACACCTTGGGCCCCTAT
GTGATCAATGTGACCAGGGCAGCGATGGCCTGCAGTCACCAGCGGTGCCATGGCCACGGGCGCTGTGCC
CGGCGAGATCCAGGACAGATGGAAGCCTTTCTACACCTGTGGCCAGACGGCAGCCTTGGAGATTGGAAG
TCCTTCAGCTGCCACTGTTACTGGGGCTGGGCTGGCCCCACCTGCCAGGAGCCCAGGCCTGGGCCTAAA
GAAGCAGTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001200029
Insert Size 1254 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001200029.1
RefSeq Size 1731 bp
RefSeq ORF 1254 bp
Locus ID 8372
UniProt ID O43820
Cytogenetics 3p21.31
Protein Families Secreted Protein
Protein Pathways Glycosaminoglycan degradation, Metabolic pathways
MW 46.5 kDa
Gene Summary This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Both variants 1 and 5 encode the same protein (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.