Kv beta 2 (KCNAB2) (NM_001199860) Human Untagged Clone

CAT#: SC329580

KCNAB2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 2 (KCNAB2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Kv beta 2
• Synonyms: AKR6A5; HKvbeta2; HKvbeta2.1; HKvbeta2.2; KCNA2B; KV-BETA-2
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329580 representing NM_001199860.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTATCCAGAATCAACGACGGGCTCCCCGGCTCGGCTCTCGCTGCGGCAGACGGGCTCCCCCGGGATG
  ATCTACAGTACTCGGTATGGGAGTCCCAAAAGACAGCTCCAGTTTTACAGGAACCTGGGCAAGTCTGGC
  CTGCGGGTCTCCTGCCTGGGACTTGGAACATGGGTGACCTTCGGAGGCCAGATCACCGATGAGATGGCA
  GAGCAGCTCATGACCTTGGCCTATGATAATGGCATCAACCTCTTCGATACAGCAGAAGTCTACGCAGCC
  GGCAAGGCTGAAGTGGTACTGGGAAACATCATTAAGAAGAAAGGATGGAGGCGGTCCAGCCTCGTCATC
  ACCACCAAGATCTTCTGGGGCGGAAAGGCGGAGACGGAGCGGGGCCTGTCCAGGAAGCACATAATCGAA
  GGTCTGAAAGCTTCCCTGGAGCGACTGCAGCTGGAGTACGTGGATGTGGTGTTTGCCAACCGCCCGGAC
  CCCAACACCCCGATGGAAGAGACCGTCCGCGCCATGACCCACGTCATCAACCAGGGGATGGCCATGTAC
  TGGGGCACGTCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCCGTGGCCCGGCAGTTCAACCTG
  ACCCCGCCCATCTGCGAGCAGGCTGAGTACCACATGTTCCAGCGTGAGAAAGTGGAGGTGCAGCTGCCG
  GAGCTGTTCCACAAGATAGGAGTGGGCGCCATGACCTGGTCCCCTCTGGCCTGTGGCATTGTTTCTGGC
  AAGTACGACAGTGGCATCCCACCCTACTCAAGAGCCTCCTTGAAGGGCTACCAGTGGCTGAAGGACAAG
  ATCCTCAGTGAGGAGGGCCGGCGCCAGCAAGCCAAGCTGAAGGAGCTGCAGGCCATCGCCGAGCGCCTG
  GGCTGCACCCTGCCCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGAGTCAGCTCCGTGCTCCTG
  GGGGCCTCCAATGCGGACCAGCTCATGGAGAACATTGGGGCAATACAGGTCCTTCCGAAACTGTCATCT
  TCCATTATCCACGAGATTGATAGTATTTTGGGCAATAAACCCTACAGCAAAAAGGACTACAGATCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199860
• Insert Size: 1104 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199860.1
• RefSeq Size: 4298 bp
• RefSeq ORF: 1104 bp
• Locus ID: 8514
• UniProt ID: Q13303
• Cytogenetics: 1p36.31
• Protein Families: Druggable Genome, Ion Channels: Other
• MW: 41 kDa
• Gene Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (3) has an alternate 5' UTR exon and encodes the same isoform 1, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.