LRTOMT (NM_001145309) Human Untagged Clone

CAT#: SC329410

LRTOMT (untagged) - Homo sapiens leucine rich transmembrane and O-methyltransferase domain containing (LRTOMT), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LRTOMT
• Synonyms: CFAP111; DFNB63; LRRC51
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001145309, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAACCCCATGGAGGAAGAGAAAGGGTATAGCAGGCCCTGGACTCCCCGACCTGTCCTGTGCTCTGG
  TCCTCCAGCCCAGGGCCCAGGTAGGGACCATGTCCCCTGCCATTGCATTGGCCTTCCTGCCACTGGTGGT
  AACATTGCTGGTGCGGTACCGGCACTACTTCCGATTGCTGGTGCGCACGGTCTTGCTGCGAAGCCTCCGA
  GACTGCCTGTCAGGGCTGCGGATCGAGGAGCGGGCCTTCAGCTACGTGCTCACCCATGCCCTGCCCGGTG
  ACCCTGGTCACATCCTCACCACCCTGGACCACTGGAGCAGCCGCTGCGAGTACTTGAGCCACATGGGGCC
  TGTCAAAGGTCAGATCCTGATGCGGCTGGTGGAGGAGAAGGCCCCTGCTTGTGTGCTGGAATTGGGAACC
  TACTGTGGATACTCTACCCTGCTTATTGCCCGAGCCCTGCCCCCTGGGGGTCGCCTTCTTACTGTGGAGC
  GGGACCCACGCACGGCAGCAGTGGCTGAAAAACTCATCCGCCTGGCCGGCTTTGATGAGCACATGGTGGA
  GCTCATCGTGGGCAGCTCAGAGGACGTGATCCCGTGCCTACGCACCCAGTATCAGCTGAGTCGGGCAGAC
  CTGGTGCTCCTGGCACACCGGCCACGATGTTACCTGAGGGACCTGCAGCTGCTGGAGGCCCATGCCCTAC
  TGCCAGCAGGTGCCACCGTGCTGGCTGACCATGTGCTCTTCCCTGGTGCACCCCGCTTCTTGCAGTATGC
  TAAGAGCTGTGGCCGCTACCGCTGCCGCCTCCACCACACTGGCCTTCCAGACTTCCCTGCCATCAAGGAT
  GGAATAGCTCAGCTCACCTATGCTGGACCAGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001145309
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001145309.3, NP_001138781.1
• RefSeq Size: 3844 bp
• RefSeq ORF: 876 bp
• Locus ID: 220074
• UniProt ID: Q8WZ04
• Cytogenetics: 11q13.4
• Gene Summary: This locus represents naturally occurring readthrough transcription between the neighboring LRRC51 (leucine-rich repeat containing 51) and TOMT (transmembrane O-methyltransferase) genes on chromosome 11. The readthrough transcript encodes a fusion protein that shares sequence identity with each individual gene product. Multiple reports implicate mutations in this gene in nonsyndromic deafness.[provided by RefSeq, Feb 2021]
  Transcript Variant: This variant (5, also known as D') represents the long transcript form. It lacks the 3' terminal exon and includes several alternate exons, compared to variant 1. This variant encodes isoform LRTOMT2a, which is a transmembrane catechol-O-methyltransferase and is supported by Western blot as reported in PMID: 18953341. Variants 4 and 5 encode the same isoform LRTOMT2a.